• Compartir en:   

Se encontraron 15 recursos para "dogma central de la biologia"

Biologia (15)
Páginas: 1

  • En celebración de la Publicación de El Origen de Las Especies

    lysenkismo, aunque mostraban cierta inclinación por el dogma... por el marxismo como dogma no por el dogma central de la genética. Por eso el rumano Buican asegura que "como la naturaleza humana, el patrimonio genético del hombre es incompatible con los dogmas del marxismo-leninismo" (19), una frase copiada de la que Sewal Wright había lanzado en la guerra fría: el suicidio de la ciencia -adviértase

    Autor: Felix Larocca  |  Publicado: 12/3/2010  |   Calificar  |   Comentar  |  Abrir en otra ventana
  • Métodos y aplicaciones de la Biología Molecular en Biomedicina

    nuevos enfoques experimentales que condujeron a lo que ha sido denominado como dogma central de la genética molecular, que establece que la información genética fluye del ADN al ARN (ácido ribonucleico) y de este a la proteína, y por tanto es el ADN el material que almacena la información genética en unidades de información hereditaria denominadas genes. Aún cuando este enunciado es cierto

    Autor: vladimirruiz   |  Publicado: 19/4/2005  |   Calificar  |   Comentar  |  Abrir en otra ventana
  • El ADN (ácido desoxirribonucleico)

    sintetice determinada proteína. Este proceso es también denominado "dogma central de la biología molecular". Por medio de los mecanismos de recombinación y mutaciones se obtienen las variaciones necesarias para adaptaciones y evoluciones. El núcleo dirige las actividades de la célula y en él tienen lugar procesos tan importantes como la auto duplicación del ADN o replicación, antes de comenzar la división

    Autor: Mayssling Blandon  |  Publicado: 7/5/2013  |   Calificar  |   Comentar  |  Abrir en otra ventana
  • ADN (ácido desoxirribonucleico)

    sintetice determinada proteína. Este proceso es también denominado "dogma central de la biología molecular". Por medio de los mecanismos de recombinación y mutaciones se obtienen las variaciones necesarias para adaptaciones y evoluciones. El núcleo dirige las actividades de la célula y en él tienen lugar procesos tan importantes como la autoduplicación del ADN o replicación, antes de comenzar la división celular

    Autor: anadiego13   |  Publicado: 7/1/2003  |   Calificar  |   Comentar  |  Abrir en otra ventana
  • El genoma humano "NOMAGE (decodificalo)"

    decodificación es el avance científico más grande en el campo de la biología

    Autor: Mariana Maury   |  Publicado: 12/12/2006  |   Calificar  |   Comentar  |  Abrir en otra ventana
  • Interacciones Microbianas, implicancias tecnológicas y Evolutivas

    antigua y asimismo la más nueva de las subdivisiones principales de la biología. Es por lo menos tan antigua como la inquisidora mente humana, imposible de ser ignorada por nuestros ancestros homínidos. Sin embargo como ciencia "dura" es joven, porque sólo recientemente los biólogos han sido capaces de idear la forma de analizar la multitud de variables que afectan

    Autor: emibacter   |  Publicado: 8/9/2003  |   Calificar  |   Comentar  |  Abrir en otra ventana
  • Alimentación animal

    menos que a poner en entredicho lo que durante décadas ha sido denominado el "dogma central" de la biología; la idea de que la información fluye sólo en un sentido, desde el genoma hasta el resto del sistema, pero no a la inversa, es una irrealidad. Hoy sabemos que el genoma es un soporte que puede ser leído, o que puede recibir información del exterior que modifica su configuración (en palabras de James

    Autor: Jesús Castro  |  Publicado: 11/1/2013  |   Calificar  |   Comentar  |  Abrir en otra ventana
  • Vias anabolicas

    conjuntos de fenómenos desasimilativos Las biomoléculas. Introducción. El dogma central de la biología molecular. Las biomoléculas y sus componentes. La célula. Agua. Interacciones reversibles entre moléculas. Aminoácidos y proteínas. Enzimas, coenzimas y vitaminas. Lípidos. Carbohidratos. Metabolismo energético. Conceptos básicos, catabolismo de carbohidratos. Glicólisis. Ciclo del ácido

    Autor: bart_j_s   |  Publicado: 10/6/2002  |   Calificar  |   Comentar  |  Abrir en otra ventana
  • Técnicas de la Biotecnología

    Cultivo de células y tejidos. Biología de la célula en cultivo. Metodología del cultivo: técnica aséptica y cámaras de flujo laminar. Ambiente de cultivo: sustratos, fase gaseosa, medios de cultivo y propiedades físicas. Uso de enzimas y fermentación microbiana. Tecnología del hibridoma

    Autor: Dayanis Jiménez   |  Publicado: 7/8/2009  |   Calificar  |   Comentar  |  Abrir en otra ventana
  • Vias anabolicas

    conjuntos de fenómenos desasimilativos Las biomoléculas. Introducción. El dogma central de la biología molecular. Las biomoléculas y sus componentes. La célula. Agua. Interacciones reversibles entre moléculas. Aminoácidos y proteínas. Enzimas, coenzimas y vitaminas. Lípidos. Carbohidratos. Metabolismo energético. Conceptos básicos, catabolismo de carbohidratos. Glicólisis. Ciclo del ácido

    Autor: bart_j_s   |  Publicado: 17/7/2002  |   Calificar  |   Comentar  |  Abrir en otra ventana
  • Ensayo sobre el libro las conexiones ocultas.

    Fritjof Capra, nace en Viena, un primero de Febrero de 1939, Doctor en física teórica por la Universidad de Viena, ha trabajado como investigador en física subatómica en la Universidad de París, en la de California (C.C.) en Santa Cruz, en el Acelerador Lineal de Londres y en el Laboratorio Lawrence Berkeley de la U.C. También ha sido profesor en la U.C. en Santa Cruz, en Berkeley y en la Universidad de San Francisco.

    Autor: Anibal Rafael Abreu Santelises   |  Publicado: 3/3/2009  |   Calificar  |   Comentar  |  Abrir en otra ventana
  • Biotecnología

    escrita en "lenguaje DNA" sería algo como esto: ATTCGGCTTACGTTGAACTGTCCATCGAGGTAACTTCCTTTTACCG (d) El Dogma Central de la Biología Con el nombre de Dogma Central conocemos el flujo de información que tiene lugar en los seres vivos desde el genotipo para (a) formar el fenotipo y (b) para transmitirse a la siguiente generación. En último término, los caracteres fenotípicos vienen determinados por la existencia de proteínas. Por ejemplo, la capacidad de tener

    Autor: elucas42   |  Publicado: 4/2/2003  |   Calificar  |   Comentar  |  Abrir en otra ventana
  • Ingeniería genética

    estructura del material genético, en 1953, nace la biología molecular y con ello se inicia una nueva etapa en la historia de la biología. El año de 1970 marca otra etapa importante: el comienzo de la manipulación enzimática del material genético, y por consiguiente, la aparición de la ingeniería genética molecular, que constituye la más reciente evolución de la manipulación genética. Los procedimientos que se utilizan reciben el nombre

    Autor: Manu Vera Fernández   |  Publicado: 18/3/2009  |   Calificar  |   Comentar  |  Abrir en otra ventana
  • Código genético

    información genética que contiene el ADN, se produce por el dogma central de la biología molecular : Hay que tener en cuenta que en las células procariotas, la transcripción y la traducción son dos procesos acoplados, de manera que a medida que se forman las cadenas de ARNm y se separan del molde, los ribosomas proceden a su traducción. En eucariota, sin embargo, son dos procesos

    Autor: ET SAPIENCE  |  Publicado: 12/8/2010  |   Calificar  |   Comentar  |  Abrir en otra ventana
  • Avances en el estudio del genoma humano

    bases nitrogenadas están orientadas hacia el eje central de la espiral y representan los peldaños de la escalera. El apareamiento de las bases entre ambas cadenas se realiza con una extraordinaria selectividad, de acuerdo con la siguiente regla: Adenina con Timina (A-T) y Citosina con Guanina (C-G) y cada 10 pares de bases

    Autor: Rocío Alfaro Luján   |  Publicado: 22/10/2008  |   Calificar  |   Comentar  |  Abrir en otra ventana
Páginas: 1