Agregar a favoritos      Ayuda      Português      Ingles     

Amelogénesis Imperfecta

Enviado por nelsonenrique



1. INTRODUCCION

2. OBJETIVOS

2.1 Objetivos General

2.2 Objetivos Especificos

3. MARCO TEORICO

3.1 Desarrollo del Diente

3.1.1 Lamina Dental

3.1.2 Etapa del Brote del Desarrollo del Diente

3.1.3 Etapa del Casquillo del Desarrollo del Diente

3.1.4 Fase de la Campanilla de Desarrollo del Diente

3.1.5 Color del Esmalte

3.1.5.1 Desarrollo del Esmalte

3.1.5.2 Mineralización de la Matriz Orgánica

3.1.5.3 Histofisiología

3.1.5.4 Ultraestructura de la Amelogénesis

3.1.5.4.1 Estadio Morfogenético

3.1.5.4.2 Estadio de Diferenciación

3.1.5.4.3 Estadio Secretor "Síntesis del Esmalte"

3.1.5.4.4 Estadio de Maduración

3.1.5.4.5 Estadio de Protección

3.1.6 Prismas

3.2 AMELOGÉNESIS IMPERFECTA

3.2.1 Ciclo Vital de los Ameloblastos

3.2.1.1 Etapa Morfogénica

3.2.1.2 Etapa de Organización (Ameloblasto Joven)

3.2.1.3 Etapa Formativa o de Secreción

3.2.1.4 Etapa de Maduración

3.2.1.5 Periodo de Protección

3.2.1.6 Etapa Desmolitica

3.2.2 Tipos de Amelogénesis Imperfecta

3.2.2.1 Tipo Hipoplasico

3.2.2.2 Superficie Irregular – Alteración de Corona

3.2.2.3 Tipo Hipoplásico

3.2.2.4 La Hipomineralización

3.2.3 Microscopia Electrónica de la Amelogénesis

4. ARTICULOS INVESTIGATIVOS

4.1 Enamelisina (Matriz Metalloproteinasa - 20) Localizacion en los Dientes en Desarrollo y Efectos del pH y del Calcio Sobre la Hidrólisis de la Amelogenina.

4.1.1 Introducciòn

4.1.2 Materiales y Metodos

4.1.3 Inmunohistoquimica

4.1.4 Resultados

4.1.5 Discusiòn

4.2 La Sucesión de Longitud Llena, Localización y Cromosomal que Trazan de Ameloblastoma

4.2.1 Procedimientos Experimentales

4.2.2 Métodos de Immunohistoquimica

4.2.3 Aislamiento de ARN y Análisis

4.2.4 Mapa Cromosomal del Gen de Ameloblastino de Ratón

4.2.5 Resultado

4.2.6 Expresión Tejido-Específica De Y224

4.3 Interacciones Proteina - A – Proteina : Criterios Definiendo la Organizacion de la Matriz Organica del Esmalte

4.3.1 Introducciòn

4.3.2 Materiales y Metodos

4.3.3 Detección Western de las Proteínas

4.3.4 Resultados

4.3.5 Discusiòn

4.4 Amelogenina, Señalan Mutación del Peptido: Correlación Entre las Mutaciones en el Gen del Amelogenina (Amgx) y Manifestaciones de la Amelogénesis Imperfecta X-Unido

5. CONCLUSIONES

6. BIBLIOGRAFIA

6.1 Del Marco Teorico

6.2 De los Articulos Investigativos

7. ANEXOS

INTRODUCCIÓN

Durante las semanas temprana que siguen el concepto de las células rápidamente que se dividen del embrión distinguen en 3 células, los tipos que forman la etapa trilaminar del disco del desarrollo: ectodermo, mesodermo y endodermo. La amelogénesis imperfecta, es una anomalía estructural hereditaria del esmalte, que ocurre en la dentición primaria y en la permanente. Se encuentra una forma hipomineralizada (defecto en la maduración del esmalte), una hipoplásica (esmalte delgado) y una hipocalcificada (defecto en la mineralización primaria). En la forma hipoplásica, hay una reducción cuantitativa del esmalte, con mineralización normal; es poco frecuente y hay variaciones en el aspecto y el genotipo. La transmisión autosómica recesiva se ha descrito en pocos casos como una anomalía de esmalte delgado, rugoso, amarillo pero duro. Se han descrito numerosos tipos de amelogénesis imperfecta que se asocian con el cromosoma X, debidos a defectos estructurales en el gen de amelogenina del cromosoma X. Se ha demostrado que el gen se encuentra en el brazo largo del cromosoma X, en el locus AIH3.

Dientes de color amarillo intenso, con presencia de esmalte delgado y frágil, compatible con amelogénesis imperfecta de tipo hipoplásico. Se evidencia presencia de pocas caries. Hay anomalía de forma dental generalizada, por la presencia de molares con cúspide en punta, sin anatomía oclusal definida, y tabla oclusal angosta. Los dientes son de tamaño pequeño, tanto en la dentición temporal como en la permanente. En este trabajo se irá a tratar lo que es en sí la Amelogénesis Imperfecta, sus principios y consecuencias.

  

OBJETIVOS

OBJETIVO GENERAL:

  • Investigar y aprender la composición de los dientes, los tipos de enfermedades que tiene la cavidad bucal, en especial la Amelogénesis Imperfecta que nos compete para nuestra carrera y empezar en firme para tener una carrera exitosa.

OBJETIVOS ESPECIFICOS:

  • Comprender la estructura, composición, etapas de los dientes y su escasez en alguna de estos componentes.
  • Reconocer la importancia de la cavidad bucal en el proceso de desarrollo y de las tranformaciones que suceden para un bien o un mal.
  • Comprender que la Amelogénesis Imperfecta es el proceso de: elaboración y mineralización de la matriz orgánica.
  • Reconocer que el Ameloblasto es funcionalmente lo mas importante para el desarrollo de los dientes y principal causa por la cual se da la Amelogénesis Imperfecta.
  • Identificar la estructura y tamaño de los Ameloblastos.
  • Reconocer e Identificar los tipos de Amelogénesis Imperfecta que hay con sus caracteristicas fisiológicas.

3. MARCO TEORICO

  1. DESARROLLO DEL DIENTE

Durante las semanas temprana que siguen el concepto de las células rápidamente que se dividen del embrión distinguen en 3 células, los tipos que forman la etapa trilaminar del disco del desarrollo: ectodermo, mesodermo y endodermo.

Estos tipos de células continúan formando todos los sistemas del cuerpo en una manera ordenada. El ectodermo se convierte para formar las estructuras tales como la piel, membranas mucosas, muchas glándulas (salivales incluyendo); el mesodermo forma los huesos, el músculo y el tejido fino conectivo, mientras que el endodermo forma las varias estructuras como los pulmones, y muchas otras estructuras abdominales.

Durante las semanas 2 y 3 hay un espesamiento del ectodermo en un canto ocurre a lo largo del disco trilaminar. Este se espesa como resultado de la mitosis crecientes dentro del ectodermo. Con el desarrollo adicional el espesamiento prolifera hacia abajo en el mesodermo para formar el tubo de los nervios: el sistema nervioso presunto.

La invasión y la diferenciación adicionales del ectodermo y en el mesodermo, en el extremo del disco embrionario que debe convertirse en la pista, da lugar a algunas células del origen ectodermal que se convierten en mas como las células mesodermal. Estas células que se llaman células ectomesenquimatoso, destacan su origen mientras que reconocen que ahora están funcionando como células del mesodermo. Las células del ectomesenquimatoso serán responsables de todos los elementos del músculo, del hueso y del tejido fino conectivo de la cara y de las quijadas.

3.1.1 Lamina Dental

Entre las semanas 5 y 6, la cavidad bucal se llena casi totalmente de la lengüeta que se convierte. El ectodermo que alinea la cavidad bucal es delgadamente epitelio escamoso estratificado. La división estarán los dientes eventual en el adulto. Esto que espesa se describe como la "lamina dental". Como invaden el ectomesenquimatoso subyacente y ramifican casi inmediatamente para formar una estructura formada invertida de "Y". La base de la Y se asocia a la superficie epitelial y los dos brazos de la Y se embuten en el mectomesenquimatoso subyacente. Un brazo de la Y, de lo mas cerca posible a la mejilla y de los labios del embrión formara el surco bucal, que separa el complejo del canto del diente alveolar de los labios y de las mejillas. El otro brazo de la Y continua invadiendo profundamente en el ectomesenquimatoso subyacente y será la base para el desarrollo de los dientes.

El ectomesenquimatoso que rodea la extensión interna del ectodermo también experimenta actividad miotica perceptible creciente. Como tal, hay una mayor densidad de las células que rodean el ectodermo invasor.

3.1.2 Etapa del Brote del Desarrollo del Diente

En 10 puntas en células de cada quijada (superior e interior) en la extremidad del ectodermo invasor experimenta mitosis creciente. Esto da lugar a una "pista pequeña" o a la formación del brote. La etapa del brote del desarrollo del diente ahora delinea las células que van a hacer el órgano dental. Estas células continuarán en formar el esmalte del diente; mientras que esas células en el ectomesenquimatoso adyacente formarán el esmalte dental, la pulpa y el cemento del diente.

En la etapa del brote hay una cierta diferenciación que ocurre dentro de las células ectodermal. Las células que están inmediatamente adyacente a la lamina basal de que separan las células ectodermal del polihedral dentro del liquido intercelular creciente.

3.1.3 Etapa del Casquillo del Desarrollo del Diente

Mientras que el nombre implica en esta etapa a el órgano dental que se convierte a un "casquillo". Dentro del centro del casquillo el ectomesenquimatoso incluido forma la papila dental. En el diente completamente formado este será la pulpa y el esmalte dental. El ectomesenchyme que rodea el órgano dental también experimenta mitosis creciente y forma una región (aunque es indistinto de los tejidos finos circundantes) llamada el "folículo dental". En el diente completamente formado estas células formara el cemento, el hueso alveolar y el ligamento periodontal.

Uno de los cambios dominantes vistos en esta época del desarrollo del diente es la diferenciación de las células del órgano dental. Las células en la capa intima (adyacente a la papila dental) se convierten en acolumnadas cuboidal o corto en forma. Hay un aumento en los organelos sintetizados de estas células (ej. Retículo endoplasmatico y aparato de Golgi). Las células distinguidas se refieren mientras que el "epitelio interno del esmalte (IEE)" y son los ameloblastos presuntos que continuaran formando el esmalte.

Inmediatamente adyacente (dentro del órgano dental) al IEE a la capa de células estratificadas distintas. Estas células se refieren como el "intermedio del estrato" (SI) y son las células especializadas que utilizan la actividad sintetizada del IEE.

La capa exterior de células del órgano dental se convierte en las células cuboidal cortas que se llaman el "epitelio externo del esmalte" (OEE). Entre el OEE y él SI al grupo de células designadas el "retículo radiado" (SR) distinga. Estas células son limitadas juntas por los desmosomas numerosos y en la etapa actual del desarrollo comienzan a secretar cantidades significativas de sustancia extracelular. Este aumento en sustancia extracelular empuja las células aparte. Sin embargo, donde son limitados por los desmosomas siguen siendo firmemente adherente. Como tal, las células toman en una estrella como aspecto (radiado), por lo tanto el nombre.

Con el desarrollo del SR hay otro cambio de concierto con mitotic creciente dentro del órgano dental, en la apariencia del histological del órgano dental. Aparece más de una "campanilla" ahora la forma.

3.1.4 Fase de la Campanilla de Desarrollo del Diente

Durante este periodo hay una continuación del diferenciación de la cuatro capa del órgano dental: IEE, SI, SR y OEE. Al mismo tiempo la capa de células de la papila dentales inmediatamente adyacente a la membrana del sótano (qué separa el IEE de la papila dental) la salida a las partes diferentes del órgano dental, la forma final de cada diente es determinada. La forma final del diente es determinada por la forma de la unión entre el IEE y los odontoblastos (ie. el dento presunto.unión de esmalte).

Las amelogeninas son proteínas, que se encuentran en el esmalte dental y en el tejido vital que sujeta al diente; el esmalte del diente es el tejido calcificado mas duro, elaborado por el tejido epitelial; se diferencia especialmente de los otros tejidos del diente por ser de origen ectodérmico, los demás tejidos del diente son de origen ectomesenquimatoso. La dureza del esmalte es considerable ya que resiste el choque masticatorio, lo cual es su principal función.

La composición del esmalte es aproximadamente de 94 % de sustancia inorgánica y un 6% de sustancia orgánica y agua.

La sustancia inorgánica esta representada en carbonato de calcio y fosfato de calcio. La sustancia orgánica esta representada por unas proteínas denominadas amelina y amelogenina. El ameloblasto tiene una mayor actividad formadora hacia la parte oclusal o incisal disminuyendo su actividad hacia la parte cervical, por esto el esmalte termina en forma de filo de navaja.

La unidad estructural del esmalte es el prisma, que mide aproximadamente 4 micras, las que se producen cada 24 horas por un ameloblasto.

3.1.5 Color del Esmalte

El color de la corona cubierta de esmalte varia desde blanco hasta grisáceo pasando por las gamas de amarillo. Se ha sugerido que el color está determinado por la translucidez del esmalte, de tal modo que los dientes amarillos tienen un esmalte traslucido y delgado a través del cual se ve el color amarillo de la dentina y que los dientes grisáceos tienen el esmalte más opaco. El color del esmalte también esta dado por la cantidad de proteína en este y el grado de calcificación que es importante para él diagnostico clínico de los pacientes.

  1. Desarrollo del Esmalte

Durante la dentinogénesis los odontoblastos se retiran centralmente, dejando por detrás dentina formada. Los ameloblastos también se retiran, pero en dirección periférica, dejando esmalte recién formado sobre dentina previamente formada. Como el epitelio dental interno termina a nivel del borde cervical, esta estructura determina la extensión de la aposición del esmalte. La dentinogénesis comienza en el estadio de campana tardío del desarrollo dentario. Inmediatamente cuando comienza la amelogénesis, el germen dentario es descripto como comenzando el estadio de corona del desarrollo del diente.

La formación de cualquier tejido duro implica esencialmente la producción de una matriz organiza dentro de la cual se introducen sales minerales. El esmalte difiere de otros tejidos duros en que es un producto ectodérmico y posee una matriz orgánica distinta con un patrón diferente de mineralización.

La formación del esmalte es un proceso complejo que comprende tres estadios. El primero es informativo e implica la secreción de una matriz orgánica por parte de las células diferenciadas a partir del epitelio dental interno, a una velocidad promedio alrededor de 0,023 mm por día. Esta matriz se mineraliza casi instantáneamente, de modo que el esmalte recién formado consta de alrededor de 65% de agua, 20% de material orgánico (proteína) y 15% de material inorgánico (apatita). La secreción de este esmalte parcialmente mineralizado continua hasta que se ha formado casi todo el espesor del esmalte, con algunas modificaciones de la matriz. Cuando se segrega por primera vez, la matriz consta de dos tipos de proteínas: una amelogenina hidrofobica rica en prolina, con un peso molecular de alrededor de 25.000 daltons y una fosfoproteina ácida glucosilada con un peso molecular alrededor de 55.000 daltons llamada enamelina. Las amelogeninas exceden a las enamelinas en un cociente de 19:1. Los cristales depositados en esta matriz son largas placas delgadas de hidroxiapatita cuya longitud se completa inmediatamente. A medida que se segrega mas matriz, las proteínas del esmalte muestran una reducción progresiva por proteólisis extracelular, y los cristales aumentan de ancho. De esta manera, la matriz del esmalte se mineraliza hasta un 30% y posee consistencia blanda. La matriz sufre el segundo estadio: la maduración, un proceso que comprende el ulterior del crecimiento de cristales de mineral y la perdida de agua y proteínas. La maduración comienza en el centro de crecimiento en el momento en que el esmalte ha alcanzado su total grosos a nivel del extremo cuspideo. Procede siguiendo el mismo patrón de la secreción de la matriz, comenzando en el limite amelodentario, radiándose hacia la superficie externa en un arco cervical a una velocidad de 0,04-0,05 mm diarios mas rápido que la secreción de la matriz. La remoción de material proteico durante la maduración es selectivo, dado que se extraen todas las amelogeninas, dejando sólo las enamelinas de mas alto peso molecular fuertemente unidas a las superficies del cristal de apatita. Se pierde alto de agua, de manera que ahora el esmalte esta altamente mineralizado, pero aún es muy poroso. El tercer estadio en la formación del esmalte resulta en el agregado de mas mineral y en la perdida de porosidad. Durante la dentinogénesis los odontoblastos se retiran centralmente, dejando por detrás dentina formada. Los ameloblastos también se retiran, pero en dirección periférica, dejando esmalte recién formado sobre dentina previamente formada. Como el epitelio dental interno termina a nivel del borde cervical, esta estructura determina la extensión de la aposición del esmalte. La dentinogénesis comienza en el estadio de campana tardío del desarrollo dentario. Inmediatamente cuando comienza la amelogénesis, el germen dentario es descripto como comenzando el estadio de corona del desarrollo del diente.

La formación de cualquier tejido duro implica esencialmente la producción de una matriz organiza dentro de la cual se introducen sales minerales. El esmalte difiere de otros tejidos duros en que es un producto ectodérmico y posee una matriz orgánica distinta con un patrón diferente de mineralización.

La formación del esmalte es un proceso complejo que comprende tres estadios. El primero es informativo e implica la secreción de una matriz orgánica por parte de las células diferenciadas a partir del epitelio dental interno, a una velocidad promedio alrededor de 0,023 mm por día. Esta matriz se mineraliza casi instantáneamente, de modo que el esmalte recién formado consta de alrededor de 65% de agua, 20% de material orgánico (proteína) y 15% de material inorgánico (apatita). La secreción de este esmalte parcialmente mineralizado continua hasta que se ha formado casi todo el espesor del esmalte, con algunas modificaciones de la matriz. Cuando se segrega por primera vez, la matriz consta de dos tipos de proteínas: una amelogenina hidrofobica rica en prolina, con un peso molecular de alrededor de 25.000 daltons y una fosfoproteina ácida glucosilada con un peso molecular alrededor de 55.000 daltons llamada enamelina. Las amelogeninas exceden a las enamelinas en un cociente de 19:1. Los cristales depositados en esta matriz son largas placas delgadas de hidroxiapatita cuya longitud se completa inmediatamente. A medida que se segrega mas matriz, las proteínas del esmalte muestran una reducción progresiva por proteólisis extracelular, y los cristales aumentan de ancho. De esta manera, la matriz del esmalte se mineraliza hasta un 30% y posee consistencia blanda. La matriz sufre el segundo estadio: la maduración, un proceso que comprende el ulterior del crecimiento de cristales de mineral y la perdida de agua y proteínas. La maduración comienza en el centro de crecimiento en el momento en que el esmalte ha alcanzado su total grosos a nivel del extremo cuspideo. Procede siguiendo el mismo patrón de la secreción de la matriz, comenzando en el limite amelodentario, radiándose hacia la superficie externa en un arco cervical a una velocidad de 0,04-0,05 mm diarios mas rápido que la secreción de la matriz. La remoción de material proteico durante la maduración es selectivo, dado que se extraen todas las amelogeninas, dejando sólo las enamelinas de mas alto peso molecular fuertemente unidas a las superficies del cristal de apatita. Se pierde alto de agua, de manera que ahora el esmalte esta altamente mineralizado, pero aún es muy poroso. El tercer estadio en la formación del esmalte resulta en el agregado de mas mineral y en la perdida de porosidad.

 

Esmalte en Formación

Esmalte en Maduración

Aminoácido

A

B

C

d

Acido Aspartico

43

39

61

96

Treonina

38

36

42

52

Serina

59

59

74

87

Acido Glutámico

150

141

128

142

Prolina

241

249

193

80

Glicina

70

74

94

109

Alanina

24

24

35

72

Cistina

1

0

0

3

Valina

41

37

42

55

Metionina

42

41

28

10

Isoleucina

35

34

35

31

Leucina

95

100

96

93

Tirosina

42

50

46

26

Fenilalanina

24

21

29

36

Histidina

55

53

39

23

Lisina

18

17

29

53

Arginina

24

24

29

33

Triptófano

No determinado

Porcentaje de Proteína

14.7

14.6

5.9

2.5

Composición en aminoácidos de muestras de esmalte extraídas secuencialmente de un incisivo superior primario de un feto que contiene tanto estadios madurativos como formativos. (Valores expresados como residuos/1000).

3.1.5.2 Mineralización de la Matriz Orgánica

El deposito inicial de mineral (mineralización parcial inmediata) se produce en la unión amelodentinaria y los cristales crecen mas tarde, siguiendo su eje longitudinal, por la progresiva adición de iones a su extremo terminal. A este nivel se localizan la DSP y la tuftelina que tienen la misión de iniciar el proceso de mineralización debido a su capacidad de unirse con el componente mineral. Se ha relacionado a la tuftelina con la hipermineralización existente en la unión amelodentaria. En la vaina de Hertwig y antes de la formación del esmalte se expresa la ameloblastina.

En estudios in vivo (utilizando el MET y el MEB) e in vitro (utilizando amelogenina recombinante se ha podido demostrar que, alrededor y entre los cristales iniciales de 1 a 3 nm de espero se disponen formaciones esféricas (nanosferas) de 20 nm constituidas por amelogeninas (cada esfera esta integrada por 100 monomeros de amelogeninas). Las nanosferas constituyen hileras en forma de rosario que con el MET se observan como estructuras electrolucidas y que previenen el crecimiento lateral y la fusión o fractura de estos cristales iniciales. Esta disposición deja libre la superficie de dichos cristales próxima al ameloblasto la cual va sucesivamente creciendo gracias al aporte de Ca2+ y de PO43- que le van suministrando los ameloblastos. La enamelina puede también participar en esta malla reticular de materia orgánica que de forma progresiva va configurando el soporte del cristal.

La disposición descrita de estas proteínas permite regular la morfología y el tamaño del cristal, modulando e inhibiendo un crecimiento anómalo del mismo o el contacto de su superficie con otras sustancias, como la albúmina, también presente en la matriz, y que es un conocido inhibidor de la hidroxiapatita y del crecimiento del cristal.

La actividad enzimática, primero de las metaloproteasas y luego de las proteasas de serina, van remodelando la matriz y degradando y eliminando el componente orgánico. Ello hace posible el crecimiento controlado de los cristales iniciales y trae como consecuencia que se establezcan puentes o bandas entre los mismos, para mas tarde y por coalescencia configurar los cristales definitivos. El proceso de mineralización avanza con la sustitución progresiva de agua y materia orgánica hasta que el esmalte alcanza un contenido en materia inorgánica del 95%.

En la ultima fase del proceso de mineralización intervendría la ameloblastina que seria segregada por la vertiente lisa de los ameloblastos y que vendría un papel fundamental en la configuración de los limites de los prismas y en la constitución de la vaina del prisma.

El aporte de calcio y fosfato para la formación y el crecimiento de los cristales proviene de los ameloblastos. El ultimo aporte de sales minerales proviene de los capilares del saco invaginados en el órgano del esmalte. El estrato intermedio selecciona el paso de iones hacia el ameloblasto, fenómeno que estaría regulado por hormonas y vitaminas (deficiencias vitamínicas o endocrinopatias producen perturbaciones que se traducen en anomalías estructurales del esmalte). En el estrato intermedio se detecta fosfatasa alcalina de forma significativa así como ATPasa dependiente del calcio. Por ultimo los métodos de autorradiografia cuantitativa del calcio al MET han puesto de relieve dos vías de difusión para este elemento:

  • Una vía transcelular a través de los ameloblastos hacia el esmalte en desarrollo.
  • Una segunda vía extracelular a través de los espacios intercelulares.

En relación con el transporte de calcio en el ameloblasto es importante destacar la significativa presencia de la actividad enzimática ATPasa dependiente del calcio que existe en distintos lugares de la celular: la membrana plasmatica, el complejo de Golgi, las mitocondrias, etc.

Existen también canales de calcio y distintas proteínas (calbindina, calmodulina, anexinas, etc.) implicadas en el transporte de dicho elemento. El calcio que penetra por las membranas basolaterales se uniría a la calbindina y seria expulsado a la matriz del esmalte gracias a la ATPasa dependiente del calcio, ubicada en la membrana que delimita el proceso de Tomes.

El esmalte adulto de un elemento ya erupcionado continua incorporando iones en su superficie, mecanismo conocido como remineralización, que esta en relación directa con el grado de permeabilidad del esmalte.

3.1.5.3 Histofisiología

El esmalte presenta características histofisiologicas que lo distinguen de los demás tejidos dentarios. El conocimiento de estas características estructurales, físicas y químicas es indispensable para poder comprender su comportamiento biológico. Teniéndolo en cuenta es posible realizar una correcta reparación de los tejidos perdidos, prevenir la caries y evitar que el mecanismo destructor de la caries se repita.

La actividad biológica fundamental en la que participa el esmalte es la de ser el soporte y la estructura donde se ejercen las fuerzas de la masticación generadas por las contracciones musculares del aparato masticatorio. Dichas fuerzas son de alrededor de 50 Kg. y en algunos individuos (los esquimales), debido a variables culturales que tienen que ver con la alimentación, dichas fuerzas alcanzan los 150 kg. La fuerza mayor se ejerce en el primer molar y la menor en los incisivos en la que la fuerza desciende hasta 10 kg. En relación con las fuerzas masticatorias es importante saber que el esmalte, que es el tejido mas duro del organismo, el mas frágil, presentando, por ello, una gran tendencia a las macro y microfracturas. El soporte dentario subyacente es el que le permite, además de su sostén, una cierta elasticidad.

Debido a su alto contenido inorgánico el esmalte es también particularmente vulnerable a la desmineralización provocada por los ácidos elaborados por las bacterias existentes en la placa bacteriana. El resultado es la caries dental y de ahí la importancia de eliminar la placa adherida a la superficie libre del esmalte con un cepillado correcto, para prevenir el inicio de la caries.

3.1.5.4 Ultraestructura de la amelogénesis

Los estudios ultraestructurales de la formación del esmalte han aportado mucho a la comprensión de este complicado proceso. Las exigencias que impone el proceso de fijación para la microscopia electrónica son tales, que muchos de estos estudios han debido realizarse en material proveniente de roedores. Afortunadamente, ya se han reportado suficientes estudios realizados sobre material obtenido de primates para poder establecer similares.

3.1.5.4.1 Estadio Morfogenético

Durante los estadios de corona y de campana del desarrollo dentario, las células del órgano dental, junto con las de la papila dental, interactuan por crecimiento diferencial para establecer la forma de la corona del diente. Mientras se hallan implicadas en esta actividad morfogenetica, las células del epitelio dental interno son cubicas con núcleos grandes ubicados centralmente. Los Complejos de Golgi se hallan en las zonas proximales de las células (el extremo adyacente al estrato intermedio). Las mitocondrias y otras organelas citoplasmaticas se hallan esparcidas en las células.

3.1.5.4.2 Estadio de Diferenciación

A medida que las células del epitelio dental interno se diferencian en ameloblastos, sé elongan y sus núcleos se desplazan para aproximarse hacia el estrato intermedio. El Complejo de Golgi aumenta de volumen y migra desde su posición proximal, para ocupar una parte importante de la porción central de la célula. La cantidad de retículo endoplasmatico rugoso aumenta significativamente y las mitocondrias se agrupan en la región proximal, aunque algunas se hallan dispersas en las células. De esta manera, el ameloblasto se convierte en una célula altamente polarizada, con la mayoría de sus organelas situadas en el cuerpo celular ubicadas distalmente respecto del núcleo.

Los ameloblastos adyacentes se hallan alineados estrechamente uno respecto del otro, y esta alineación se mantiene mediante el agregado de especializaciones de contacto, o Complejos de Unión, establecidos entre ellos. Estos Complejos de unión rodean las células a nivel de sus extremos distal (más cercana a la dentina) y proximal. Tonofilamentos finos radian desde los Complejos de Unión dentro del citoplasma de los ameloblastos, y se los distingue formando barras terminales proximal y distal. Muy a menudo el complejo de la barra terminal proximal aparece bajo el microscopio óptico como una capa continua que separa los ameloblastos del estrato intermedio, pero esta es una ilusión causada por el microscopio óptico.

Ultimamente ha quedado claro que existe una diferencia funcional entre los complejos de unión proximal y distal. Experimentos en los cuales se usa peroxidasa de rabanito picante o lantano, como trazadores demuestran que dichos materiales son capaces de pasar entre las uniones proximales (permeables a ellos) hacia los espacios paracelulares y, por lo tanto, las uniones son de la variedad macular (puntual).

Ninguno de los dos trazadores, sin embargo pasa mas allá de la unión distal, la cual pertenece a la variedad zonular (que rodea a toda la célula). El sellado del complejo de distal solo ocurre a medida que los ameloblastos asumen su función secretoria, dado que se ha demostrado que antes que comience la secreción ellos son permeables.

La lamina basal sobre la cual se apoyan los ameloblastos se desintegra después del comienzo de la amelogénesis.

3.1.5.4.3 Estadio Secretor "Síntesis del Esmalte"

La ultraestructura del recientemente formado ameloblasto refleja su futura función sintética y secretora. La síntesis de la proteína del esmalte verifica en el retículo endoplasmatico rugoso desde donde pasa al Complejo de Golgi, en donde se condensa y empaqueta en gránulos secretorios rodeados por una membrana. Estos gránulos migran a la extremidad distal de la célula, y su contenido es liberado contra la recientemente formada la dentina del manto. Hay poco o ningún intervalo entre la secreción de la proteína del esmalte y la aparición de esmaltes inorgánicos dentro de ella. Estos cristales están empaquetados al azar en el esmalte que se forma primero y se interdigitan con los cristales de la dentina. Algunos consideran que los cristales de la dentina forman los sitios de nucleación para los cristales del esmalte.

A medida que se forma esta primera capa amorfa del esmalte, los ameloblastos se alejan de la superficie de la dentina y cada ameloblasto desarrolla una proyección cónica corta conocida como proceso de Tomes. Aunque el citoplasma de un ameloblasto se continua con el proceso de Tomes, la distinción entre proceso y cuerpo celular esta marcada claramente por el complejo de unión (la barra terminal). El proceso contiene primariamente gránulos secretorios y pequeñas vesículas, mientras que el citoplasma del ameloblasto contiene abundantes organelas sintetizadoras.

Una vez que se establecen los procesos de tomes, la secreción de la proteína del esmalte por parte de los gránulos secretorios se verifica a través de estrechos canales que están localizados primariamente en dos regiones dentro de estos procesos, especialmente en sus extremos dístales y en la extremidad proximal donde se unen procesos adyacentes. Sin embargo, los tiempos se superponen un poco, de modo que la secreción a nivel de la distal, formando de esta manera fositas amuralladas ocupadas por el extremo distal del proceso.

Estas fositas después se llenan de secreción desde una de las superficies del proceso de Tomes. El proceso de Tomes crea una estructura en el esmalte. El proceso de Tomes persiste hasta la formación de los pocos incrementos finales de esmalte, que es también amorfo, y se lo conoce como esmalte aprismático.

3.1.5.4.4 Estadio de Maduración

Una vez que se ha formado todo el espesor de la matriz del esmalte, los ameloblastos sufren cambios ultraestructurales significativos ligados a su nueva función de maduración del esmalte. Hay una breve transición que implica una reducción de altura del ameloblasto y una disminución de su volumen y contenido de organoides. Las organelas excedentes, asociadas con la síntesis, sin encerradas en vesículas autofagicas y son digeridas por enzimas lisosomales. Este desarrollo es seguido por un desplazamiento en muchas de las organelas que quedan en la parte distal de la célula y por un plegamiento en muchas de las organelas que quedan en la parte distal de la célula y por un plegamiento complicado de la membrana plasmatica distal para formar un borde estriado. Este borde estriado aumenta enormemente la superficie de la extremidad del ameloblasto e indica que hay rápido transporte de material a través de la membrana plasmatica.

Ya se ha mencionado que durante la maduración, hay cambios cualitativos y cuantitativos en el componente orgánico del esmalte, y que el ameloblasto puede hallarse implicado en la remoción selectiva de material orgánico. Los estudios morfológicos han revelado material parecido a la matriz del esmalte entre las prolongaciones del borde estriado y dentro de las vacuolas presentes en el ameloblasto. Otros estudios, en los cuales los componentes orgánicos del esmalte se marcaron con isótopos radioactivos, también indican que hay material orgánico que sale de la matriz del esmalte formada y que penetra en el ameloblasto en maduración (absortivo).

Al igual que los otros cambios que ocurren dentro del componente orgánico del esmalte, la maduración también implica el rápido influjo de calcio y fosfato. Esta acción permite el rápido crecimiento de los cristales, que se verifica para ocupar los espacios formados a medida que se remueven el agua y el material orgánico. El proceso por el cual estos iones inorgánicos son introducidos en un cierto momento dentro del esmalte no se comprende del todo. Se ha observado que grandes grupos de ameloblastos en maduración alternan entre fases en las cuales poseen una superficie distal-suave o la típica superficie estriada. Parece que puede haber patrones cíclicos de función celular (remoción proteica e influjo de calcio), los que se relacionan con esas características morfológicas. El esmalte adyacente a los ameloblastos con superficies estriadas parece hallarse mas densamente implicado en la captación de calcio. Se ha sugerido que el desarrollo del borde estriado y la fosfatasa alcalina a lo largo del mismo reflejan el rapido pasaje de iones inorgánicos a través de la membrana celular durante la maduración del esmalte.

El crecimiento de los cristales del esmalte ocurre como se describe a continuación. Cuando los cristalitos comienzan a aparecer tienen aproximadamente 3,1 nm de espesor y 29 nm de ancho y se hallan densamente empaquetados (1.240 cristalitos por m m2). Tales cristales crecen entonces rápidamente en ancho y más lentamente en espesor hasta que llegan a un ancho promedio de aproximadamente 65 nm. El crecimiento en espesor continua por un tiempo más, hasta que se llega a un grosor promedio de 25 nm en el esmalte maduro, el cual contiene aproximadamente 560 cristalitos por micrómetro cuadrado. Esta disminución en el numero de cristalitos por unidad de superficie es creado no solamente por el crecimiento de los cristalitos, sino también por la fusión de los cristalitos entre sí.

3.1.5.4.5 Estadio de Protección

A medida que la maduración del esmalte llega a su termino, los ameloblastos pierden sus bordes estriados y segregan un material entre el extremo distal de la célula, ahora achatado, y la superficie del esmalte, el cual aparece morfológicamente idéntico a una membrana basal. También en este momento se forman hemidesmosomas a lo largo de la membrana celular distal. Estas estructuras, junto a la lamina basal, proveen de un medio de unión firme para los ameloblastos a la superficie del esmalte, el cual es especialmente importante para el establecimiento de la unión dentogingival.

3.1.6 Prismas

El esmalte esta formado por bastones o prismas, vainas y una sustancia interprismática de unión. Se ha calculado que él numero de prismas del esmalte va desde cinco millones, en los incisivos laterales inferiores, hasta doce millones en los molares superiores. Los prismas no son completamente rectos sino presentan algunas curvaturas, en especial en la porción oclusal. La translucidez del esmalte parece ser debida a variaciones del grado de calcificación. Los prismas son los más calcificados en cambio la sustancia intercélular es menos calcificada que el prisma y las vainas son ligeramente menos calcificadas de la sustancia cementante.

El microscopio también muestra otras estructuras del esmalte, al estudiar un corte por desgaste, estas son las bandas de Hunter Schregaer, bandas de Retzius, laminillas del esmalte. Algunas de ellas tienen poca importancia clínica.

Las laminillas de esmalte son estructuras delgadas foliculares que se extienden desde la superficie externa del esmalte a la unión amelodentinal, su composición es de material orgánico y bajo contenido mineral.

Se distinguen tres tipos de laminillas de esmalte:

  • Tipo A: Poco calcificada.
  • Tipo B: Constituidas por restos de células en degeneración.
  • Tipo C: Constituidas por resquebrajaduras que se llenan de material orgánico presumiblemente originadas por la saliva.
  1. AMELOGÉNESIS IMPERFECTA

La amelogénesis es el proceso del esmalte que comprende:

  • La elaboración de una matriz orgánica extracelular
  • La mineralización casi inmediata de la misma.

Ambos procesos están íntimamente ligados en el tiempo, luego de describir los ameloblastos que son las células formadoras del esmalte. Los ameloblastos se diferencian a partir del epitelio interno del órgano del esmalte y alcanzan un alto grado de especialización. En el proceso de diferenciación se requiere de la presencia de dentina. Debido a ello, la diferenciación se inicia en la región del futuro extremo cuspideo del germen dentario, siguiendo la dentina en desarrollo y se propaga en dirección de las asas cervicales hasta que todas las células del epitelio dental interno se transforman en ameloblastos. El extremo del asa cervical del órgano del esmalte, determina la extensión de la aposición del esmalte ya que los ameloblastos del epitelio interno solo llegan hasta ese nivel.

Estructura y ultraestructuralmente, el ameloblasto constituye la unidad funcional, dado que es la única célula responsable de la secreción de la matriz organiza del esmalte.

El esmalte que esta compuesto por dos clases de proteínas: la enamelina y la amelogenina. A ubicación de los disturbios genéticos que afectan a formación del esmalte es conocida como amelogénesis imperfecta.

Una proteína defectuosa en AI como la amelogenina (controla la mineralización del esmalte).

El gen está localizado en un brazo corto de los cromosomas X y en la localidad correspondiente; no-cromosoma Y.

Ocurre en una proporción de 1/14.000 que se forman varios tipos de herencia: dominante ligada al cromosoma X, resecivo ligado a X, autosomica dominante y autosomica recesiva.

El esmalte es el tejido ectodérmico que cubre la corona anatómica del diente. Esta formado por el órgano dental, el cual deriva de una proliferación localizada del epitelio oral. Las células que forman el esmalte, los ameloblastos, se diferencian dentro del epitelio dental interno como una parte del órgano dental. Debido a este proceso de diferenciación requiere la presencia de dentina, este comienza en la región del futuro extremo cuspideo de germen dentario; siguiendo la dentina el desarrollo, y propagándose hacia abajo de las vertientes cuspideas hasta que todas las células del epitelio dental interno se han convertido en ameloblastos.

3.2.1 Ciclo Vital de los Ameloblastos

Durante el desarrollo del germen dentario los ameloblastos atraviesan una serie sucesiva de etapas, que abarcan todos los cambios que sufren estos elementos desde que las células poseen un carácter absolutamente indiferenciado hasta que, tras diferenciarse y madurar, desaparecen por completo. Cada una de las etapas se caracteriza por presentar cambios estructurales citoquimicos y ultraestructurales que dependen del estado funcional, que poseen las células en relación con los procesos de formación o maduración del esmalte.

Las etapas o periodos que constituyen el ciclo vital del ameloblasto, son las siguiente:

Etapa Morfogénica (preameloblasto)

Etapa de organización o diferenciación (ameloblasto joven)

Etapa formativa o de secreción (ameloblasto activo, secretor o maduro)

Etapa de maduración

Etapa de protección

Etapa desmolítica

El desarrollo de los ameloblastos progresa desde los bordes incisales o cuspideos hacia el asa cervical, por lo cual, en un solo corte histológico de la etapa aposicional pueden observarse la mayoría de las características histológicas del ciclo vital de los ameloblastos.

  1. Las células del epitelio interno del órgano esmalte interactuan con las células ectomesenquimaticas de la papila determinando la forma de la CAD y de la corona.

    Los preameloblastos con células cilíndricas bajas con grandes núcleos ovalados, ubicados en la región central que ocupan, casi por completo, el cuerpo celular. El Complejo de Golgi y los centriolos están localizados en el extremo basal de la célula (sector adyacente al estrato intermedio), mientras que las mitocondrias se hallan distribuidas uniformemente por todo el citoplasma. En el extremo apical existen cisternas desarrollados de unión intercelulares.

    En un corte histológico del germen dentario, en estadio de campana aposicional, se localizan cerca del asa cervical.

    El epitelio interno del órgano del esmalte esta separado del tejido conectivo de la papila dentaría por una delgada lamina basa, la lamina basal ameloblástica (LBA), que contiene laminina, colágeno tipo IV, ectanina, heparán sulfato y fibronectina. La capa pulpar adyacente presenta una zona acelular, clara y angosta que desde el punto de vista histoquímico es metacromática y alcianófila. Los preameloblastos muestran abundantes prolongaciones citoplasmáticas, que se extienden desde la superficie apical (limite con la papila dental) hasta la matriz intercelular en la que penetran. Estas prolongaciones entran en contacto con las células ectomesenquimáticas de la papila, Posiblemente podrían desempeñar un papel importante en las interacciones epitelio-ectomesénquima. En este periodo intervienen distintos factores tales como el TGF-b , FGF y EGF que inciden sobre la diferenciación general de las células que forman el estadio de casquete del germen dentario. En los preameloblastos (epitelio dental interno) los receptores Nocth y EGF están disminuidos en relación con las células del epitelio dental externo del órgano del esmalte.

    En los preameloblastos de esta etapa morfogenética se inicia la expresión y la secreción de tuftelina, de sialofosfoproteina dentanaria (DSP) y de ATPasa dependiente del calcio.

  2. Etapa Morfogénica
  3. Etapa de Organización (Ameloblasto Joven)

En esta etapa que coincide con el periodo de campana, las células del epitelio interno del esmalte, que siguen expresando niveles bajos de receptores Nocth y EGF inducen, mediante la elaboración de TGF-b , a las células mesenquimáticas del tejido conectivo adyacente a diferenciarse en odontoblastos. En este periodo los ameloblastos cambian de aspecto: las células se alargan, cambian de polaridad, las organelas y el núcleo se dirigen hacia basal (estrato intermedio).

El citoplasma muestra un cierto grado de desarrollo de RER (basofilia cada vez más intensa), y del Complejo de Golgi, las mitocondrias se agrupan en la región basal, y se observan numerosos microfilamentos y microtubulos. Los ameloblastos se hallan alineados estrechadamente uno respecto del otro, a través de especializaciones de contacto o complejos de unión que se localizan a nivel de los extremos básales y apicales de las células. Se ha establecido que existen diferencias funcionales entre ellas. Las uniones mas apicales son del tipo macular (puntual) u permeables al paso de algunas sustancias hacia los espacios intercelulares. Las uniones básales pertenecen a la variedad zonular (rodean a toda la célula) y son impermeables al paso de algunas sustancias hacia los espacios intercelulares. Las uniones mas básales pertenecen a la variedad zonular (rodean a toda la célula) y son impermeables al paso de sustancias.

Los Tonofilamentos que se proyectan desde las uniones de la membrana hacia el citoplasma de los ameloblastos, forman las barras terminales apicales y básales. Existen desmosomas bien desarrollados que se ven, tanto en la región apical, como en la basal.

A zona clara y acelular entre el epitelio interno y la papila dentaría desaparece quizás por el alargamiento de las células epiteliales que se ponen en contacto con las células de la papila, las cuales han comenzado su diferenciación en odontoblastos. Hacia el final del periodo de organización comienza la secreción de dentina por parte de los odontoblastos. Cuando esto ocurre se desarrolla una inversión de la corriente nutricia, al quedar separados los ameloblastos de la papila dentaría, su fuente primitiva de nutrición. Ahora su nutrición procede de los capitales del saco dentario que rodean al órgano del esmalte y que penetran con el epitelio externo por invaginación hacia el estrato intermedio. El cambio de polaridad que el ameloblasto joven sufre en esta, esta relacionado con una reprogramación de los mecanismos celulares que controlan el trafico vesicular, dado que a partir de esta fase, se va a desarrollar una intensa síntesis de secreción de proteínas del esmalte. En los ameloblastos jóvenes que todavía conservan la capacidad de dividirse puede ya detectarse la presencia de amelogenina.

3.2.1.3 Etapa Formativa o de Secreción

El ameloblasto secretor es una célula diferenciada, muy especializada que ha perdido la capacidad de dividirse por mitosis. La población de preameloblastos constituye por ello una fuente constante de provisión de ameloblastos.

Los ameloblastos secretores son células cilíndricas y delgadas de unos 60 m m de altura. Entre sus caras laterales existen sistemas de unión semejantes a los descritos en la etapa anterior, observándose pequeños espacios interameloblasticos hacia los que las células proyectan pequeñas microvellosidades. Al MO el citoplasma es fuertemente basofilo, debido a un ergastoplasma bien desarrollado (típico de células excretoras), y el núcleo es grande con cromatina laxa y un nucleolo evidente. El núcleo del ameloblasto se encuentra ahora en el polo basal, o sea en el polo opuesto a la futura CAD.

Al ser una célula secretora, desde el punto de vista ultraestructural presenta las siguiente características: abundantes mitocondrias (polo secretor); Complejo de Golgi constituido por varios dictiosomas en la misma zona; RER distribuido por toda la célula y más desarrollado en el polo apical; microfilamentos de tubulina, a -actinina, vinculina y prequeratinas que se disponen a lo largo de la célula constituyendo el citoesqueleto y cuya integridad resulta necesaria para la diferenciación total y la secreción de los ameloblastos.

En el citoplasma de los ameloblastos secretores se han descrito vesículas denominadas cuerpos ameloblasticos o cuerpos adamantinos que son formaciones de tipo granular, consideradas como precursores intracelulares de la matriz orgánica del esmalte. Se localizan cerca del Complejo de Golgi en el cual tienen su origen. Poseen morfología ovoidea y contienen un material granular muy fino, rodeado por membrana.

El contenido de los cuerpos ameloblasticos no se conoce con exactitud. Por una parte, se supone que su naturaleza es proteica y que contiene constituyentes propios de la matriz orgánica del esmalte. Algunos autores consideran que podrían contener sales minerales cálcicas en forma soluble. Los gránulos secretorios o cuerpos ameloblasticos, una vez formados en el Complejo de Golgi, migran hacia el polo apical de la célula, donde son liberados contra la dentina formada. La secreción de proteínas del esmalte y la aparición de cristales inorgánicos dentro de ellas, es casi simultanea. Los cristales del esmalte se forman primero se interdigitan con los cristales de la dentina. A medida que se forma esta primera capa amorfa de esmalte (esmalte aprismático), los ameloblastos se alejan de la superficie de la dentina y cada uno desarrolla una proyección cónica denominada proceso de Tomes.

Los sistemas de unión más próximos al polo apical, marcan con claridad el limite entre el cuerpo celular del ameloblasto y el proceso de Tomes. Es decir, que el ameloblasto secretor en esta etapa del ciclo se caracteriza desde el punto de vista morfológico por la presencia del proceso de Tomes, estructura responsable por la formación de prismas y la disposición de los cristales dentro del mismo.

En el proceso de Tomes la membrana ofrece dos patrones de superficie: uno de ellos presenta invaginaciones, mientras que el otro ofrece una superficie más lisa. La presencia del proceso de Tomes supone la ruptura de la membrana basa, que se produce por la acción lítica de enzimas lisosómicas procedentes de los ameloblastos o por enzimas derivadas del odontoblasto. El citoplasma del proceso de Tomes contiene gránulos secretores (cuerpos ameloblasticos), pequeñas vesículas, mitocondrias y microfilamentos. Las dos vertientes membranosas del proceso de Tomes representan dos áreas distintas de secreción: a) el polo secretor que presenta invaginaciones es el responsable de formar el esmalte de la cabeza de los primas. Los cristales que se depositan sobre la materia orgánica se disponen perpendicularmente a la superficie del polo secretor; b) el polo secretor de superficie lisa es el responsable de la formación del esmalte de la cola del prisma adyacente. Los cristales aquí depositados tienden a ser también perpendiculares a la superficie.

Ambas secreciones y su posterior mineralización darán lugar a la organización de los primas y a la orientación de los cristales en el seno de los mismos. La secreción de la cola de un prima precede a la de la cabeza del siguiente, lo que configura una fosita ocupada por el resto del proceso de Tomes. Esta fosita se llena mas tarde con la secreción elaborada por el polo secretor de la cabeza. Se desconocen si existe mecanismos selectivos de polaridad en la elaboración, transito y secreción, en el ameloblasto, hacia cada una de las vertientes del proceso de Tomes.

Se admite que en la formación de cada prisma intervienen cuatro ameloblastos y que cada ameloblasto contribuye a formar cuatro prismas.

La presencia y el desarrollo del proceso de Tomes, están asociados principalmente con la formación del esmalte prismático. Esto explica que el esmalte se deposita inicialmente aprismático. También se suele encontrar una fina capa aprismática en la superficie externa del esmalte. Es decir, que el prima se forma solo cuando la prolongación citoplasmatica apical está presente.

Los ameloblastos están unidos por desmosomas a las células del estrato intermedio. Al parecer cada célula del estrato intermedio esta relacionada con seis ameloblastos, a los que coordina en los desplazamientos que estos efectúan en el proceso de formación de los prismas del esmalte. El desplazamiento vertical hacia atrás de los ameloblastos, seria semejante al que realizan también otras células que forman tejidos duros, tales como los osteoblastos y los odontoblastos. Sin embargo, los desplazamientos laterales y, en algunos casos, en torsión necesarios para formar algunos prismas podrían ser únicos de los ameloblastos. Los ameloblastos próximos a la cúspide son los primeros que alcanzan la máxima diferenciación secretora para sintetizar y segregar las proteínas especificas de la matriz del esmalte.

  1. La maduración se produce después de haberse formado la mayor parte del espesor de la matriz del esmalte en el área oclusal o incisal (en las partes cervicales de la corona, la formación de la matriz del esmalte todavía continua). En esta etapa los ameloblastos reducen ligeramente su tamaño, aumentan su diámetro transversal y su Complejo de Golgi y su RER disminuye de volumen. Las mitocondrias se sitúan en el polo apical y el numero de lisosomas y autofagosomas, con un contenido semejante al de la matriz organiza del esmalte, aumentan considerablemente. El proceso de Tomes desaparece y en el polo apical surgen microvellosidades e invaginaciones tubulares a las del osteoclasto.

    La presencia de estas estructuras demuestra que en esta etapa las células tienen capacidad absortiva lo que les permite participar eliminando agua y matriz orgánica del esmalte.

    La eliminación del componente orgánico facilita espacio para que se incremente el porcentaje de componente inorgánico y se vaya configurando el esmalte maduro. En esta etapa, además de la reabsorción se ha comprobado que disminuye, aunque no de forma completa, la producción de las proteínas del esmalte. El ameloblasto en esta etapa sintetiza abundante ATPasa dependiente del calcio y numerosas enzimas lisosomicas y progresivamente fosfatasa alcalina. El pH existente en la matriz, junto al polo apical cuando la acidez alcanza un determinado limite y puede desmineralizarse los cristales de esmalte que se están formando. Se ha sugerido que el contacto con altas concentraciones de flúor podría acidificar este micromedioambiente.

    En la fase de transición entre la etapa secretora y la de maduración se ha demostrado que muere el 25% de la población ameloblastica y durante la etapa de maduración lo hace el otro 255. El resto de las células (50%) debe ocupar el espacio previo existente y de ahí el carácter mas aplanado que presenta la morfología de los ameloblastos.

  2. Etapa de Maduración

    Cuando el esmalte depositado se ha mineralizado en su totalidad, el ameloblasto entra en su estado de regresión. Los ameloblastos dejan de estar organizados en una capa definida, ya no pueden distinguirse de las células del estrato intermedio y, en consecuencia, se fusionan con el resto de las capas del órgano del esmalte. En los ameloblastos las organelas disminuyen de volumen y el Complejo de Golgi vuelve a su posición inicial en el polo basal, junto a las células del estrato intermedio. Estos estratos celulares no distinguibles constituirán, finalmente, una capa estratificada denominada epitelio reducido del esmalte o epitelio dentario reducido, cuya función es la de proteger el esmalte maduro, separándolo del tejido conectivo hasta la erupción del elemento dentario. El ultimo producto de secreción de los ameloblastos es la llamada cutícula primaria o membrana de Nasmyth.

  3. Periodo de Protección
  4. Etapa Desmolitica

El epitelio reducido del esmalte e induce la atrofia del tejido conectivo que lo separa del epitelio bucal, de este modo pueden fusionarse ambos epitelio. Las células del epitelio dentario elaboran enzimas que destruyen el tejido conectivo por desmólisis.

Si se produce una degeneración prematura del epitelio reducido puede no haber erupción.

3.2.2 Tipos de Amelogénesis Imperfecta

Las alteraciones que afectan a la formación del esmalte pueden ser de origen genético o de origen medioambiental dado que el ameloblasto es una célula muy sensible a los cambios de su entorno. Los defectos pueden afectar solo a una pequeña área de la superficie del esmalte o, por el contrario, a todo el espesor del mismo. De forma similar la alteración puede ser localizada afectando a uno o dos dientes o generalizada afectando a muchas piezas dentarías o incluso a toda la dentición. Los defectos pueden ser, además, simétricos o asimétricos respecto de la línea media de dentición.

De entre los procesos arriba indicados aquellos que cursan con un cuadro febril importante, como por ejemplo la fiebre tifoidea, dan lugar a bandas mal formadas en la superficie del esmalte que se originan durante el proceso de amelogénesis. La administración de tetraciclinas puede dar un origen a una banda de pigmentación gris o incluso a una pigmentación total de la estructura del esmalte. Ello se debe a la incorporación del antibiótico a los tejidos que se están mineralizando.

La exposición aguda o crónica al flúor en dientes en desarrollo origina alteraciones importantes en la amelogénesis. Al parecer el mecanismo es la degradación alterada de la amelogenina por las proteasas en la fase de maduración y formación del esmalte. Esto da origen a la retención de la amelogenina y a la formación de áreas de esmalte irregular.

Estructuralmente se observa una capa hipermineralizada externa y una capa hipomineralizada ubicada mas internamente en el esmalte. Desde el punto de vista clínico se observa un esmalte moteado que aunque poco estético es resistente a la caries al estar constituido los cristales por fluorapatita.

En relación con las alteraciones genéticas que conducen a la amelogénesis imperfecta se acepta que esta denominación debe quedar restringida a defectos congenicos que afecten solo a la formación del esmalte (alteración de la amelogénesis no sindromica), y no a aquellas alteraciones en la formación del esmalte que acompañan a otros defectos metabólicos y morfológicos presentes en otros sistemas corporales (alteraciones de la amelogénesis sindromica).

No debe olvidarse que como el esmalte es de origen ectodermico la alteración de su formación puede acompañar a la alteración de otros derivados ectodermicos, como el pelo, las uñas, la piel, etc. De acuerdo con criterios clínicos y radiograficos se distinguen tres grandes grupos en la amelogénesis imperfecta: el tipo hipoplasico, en el que existe una reducción cuantitativa del esmalte, pero con una buena mineralización, el tipo hipocalcificado, en el que existe una mineralización defectuosa, pero el volumen adamantino es prácticamente normal y el tipo hipomaduro, en el que se desarrollan distintas alteraciones en la configuración de los prismas durante las ultimas etapas del proceso de mineralización.

Entre los complejos sindromicos en los que existen alteración en la formación del esmalte se encuentran los síndromes de Aarskog y de Goltz cuya transmisión hereditaria esta ligada al cromosoma X y el síndrome Trico-dento-óseo cuya transmisión es autosomica dominante.

La diferenciación hacia ameloblastos de algunas zonas aisladas del epitelio radicular de Hertwig dan lugar a la formación de nódulos de esmalte de 1 a 2 mm de diámetro en las raíces. Dichas formas denominadas perlas adamantinas o del esmalte se encuentran con mayor frecuencia en las zonas de bifurcación de las raíces de los molares permanentes.

3.2.2.1 Tipo Hipoplasico

La herencia autosomica dominante, elabora en algunos casos por tratarse de herencia dominante ligada a X.

Apesar de que la matriz es defectuosa, la calcificación se establece correctamente.

El esmalte es irregular, delgado y con depresiones, mas presenta dureza y absorbencia normal.

3.2.2.2 Superficie Irregular - Alteración de Corona

El tipo dominante ligado a X es inusitado, visto que los dientes de sexo masculino tienen poco esmalte, o volumen como la corona se reduzca a la dentina.

El sexo femenino tiene una espesura de esmalte normal, con fisuras y surcos verticales .

3.2.2.3 Tipo Hipoplásico

Características los dientes:

  • Esmalte muy duro y fino.
  • Dientes pequeños y con superficie áspera.
  • Incisivo de forma cuadrada

Presentan:

  • Abrasión en los dientes superiores
  • Dientes opacos, mas con ligera variación de color, común en los caninos.

No presentan:

  • Dientes con bandas verticales de esmalte opaco alternado con esmalte de m coloración normal y translúcido.
  • Esmalte uniformemente liso y duro, con ondulaciones sutiles en su superficie.
  • Grande cantidades de matriz de esmalte poco calcificada.

los cristales de esmalte no maduran .

El esmalte es afectado es el menos duro o esmalte de Hipocalcificación.

La coloración varia de blanco a marrón (malteado).

Esmalte es mas fino que lo normal.

Herencia recesiva ligada a X que afecta ambas denticiones.

3.2.2.4 La Hipomineralización

Puede ser por herencia autosomica o recesiva.

El esmalte se forma en cantidades normales, una vez que no existe defecto en la matriz.

El diente presenta consistencia de gris, mole y opaco.

El esmalte se desprende de los dientes recién que erupcionan rápidamente, dejando la dentina completamente expuesta al contacto generando un alto grado de sensibilidad.

Los dientes no presentan brillo.

Se afecta tanto la dentición temporal como la permanente.

Las radiografías demostraron que la dentina es mas radiopaca que el esmalte.

Este tipo de amelogénesis es causada probablemente por una alteración del gene responsable de la formación de la matriz de la dentina, impidiendo la iniciación de procesos de calcificación normal.

Sexo masculino: son lo mas afectados, presentando dientes blanco - amartelados, que se oscurecen por la absorción de pigmento.

Dientes frágiles con mucha abrasión.

3.2.3 Microscopia Electrónica de la Amelogénesis

En el estadio tardío de corona del desarrollo dentario la mayoría de las características microscópicas de la amelogénesis puedan verse en un solo corte. Así, en la región del borde cervical, las células cilíndricas cortas del epitelio dental interno pueden identificarse claramente, apoyadas por una membrana basal que las separa de la zona acelular de la papila dental. Estas células poseen un alto contenido de glucógeno. Periféricamente, respecto del epitelio dental interno, se ubica el estrato intermedio, el retículo estrellado y el epitelio dental externo, este ultimo formando una barrera epitelial a los vasos sanguíneos que tapizan la periferia del órgano dental. El estrato intermedio se halla solo en relación con el epitelio dental interno durante el desarrollo de la corona (no existe en la vaina radicular). Sus células, que poseen alta actividad de fosfatasa alcalina, deberían considerarse junto con los ameloblastos como una sola unidad funcional para la producción del esmalte.

A medida que el epitelio dental interno se localiza coronalmente en un germen dentario en estadio de corona, sus células se hacen cilíndricas altas y sus núcleos se alinean en el extremo proximal de las células adyacentes al estrato intermedio. En esta región la zona acelular de la papila dental se ve que ha ido desapareciendo a medida que los odontoblastos se han diferenciado y comenzado la secreción de dentina. Inmediatamente después de la formación de dentina ha comenzado, hay una serie de cambios morfológicos distintivos y casi simultáneos asociados con el comienzo de la formación del esmalte, que tienen lugar en el órgano dental. Las células del epitelio dental interno, ahora llamadas ameloblastos, comienzan a segregar matriz del esmalte, la cual se puede identificar fácilmente como una capa intensamente teñida en cortes teñidos de hematoxilina eosina. A medida que se forma este primer incremento del esmalte, los ameloblastos comienzan a alejarse de la superficie de la dentina, y enseguida cada célula forma una proyección cónica corta. Estas proyecciones, llamadas procesos de Tomes, entran en el esmalte recientemente formado, dándole a la unión entre el esmalte y los ameloblastos un aspecto de serrucho.

En este momento el órgano dental se colapsa. El volumen, junto a la migración hacia la periferia de los ameloblastos, hace que los vasos sanguíneos se sitúen mas cerca de los ameloblastos en el folículo dental. Esta nueva fuente de irrigación de los ameloblastos desde folículo dental, de la que había sido privada por la formación de dentina. Se piensa que durante la transición en el aporte nutritivo, los ameloblastos dependen de su contenido de glucógeno.

A medida que prosigue la formación de la matriz del esmalte, las células del epitelio dental externo, el retículo estrellado y el estrato intermedio pierden gradualmente sus identidades y forman una capa escamosa adyacente a los ameloblastos. Con la terminación de la formación de la matriz del esmalte, los ameloblastos se acortan ligeramente, pierden los procesos de Tomes, y se implican en la maduración de la matriz del esmalte. Una vez que la maduración se ha completado, la capa ameloblastica interna, junto con el epitelio estratificado adyacente (derivado del estrato intermedio del retículo estrellado y del epitelio dental externo) constituyen el epitelio dental reducido (o epitelio reducido del órgano del esmalte) que cubre el esmalte recientemente formado. Este epitelio es inactivo, pero posee una función protectora. Si hay en él una ruptura prematura, las células del tejido conectivo se ponen en contacto con el esmalte y depositan cemento sobre el esmalte, u ocasionan zonas de reabsorción localizada del esmalte. En la mayoría de los cortes descalcificados del esmalte maduro, se puede distinguir poco del tejido debido a que, a medida que se mineraliza, su componente orgánico se pierde progresivamente. Solo en el esmalte inmaduro o en el esmalte muy cuidadosamente desmineralizado hay suficiente material orgánico presente como para revelar histologicamente la organización estructural de este tejido.

 4. ARTICULOS INVESTIGATIVOS

4.1 ENAMELISINA (MATRIZ METALLOPROTEINASA - 20) LOCALIZACION EN LOS DIENTES EN DESARROLLO Y EFECTOS DEL pH Y DEL CALCIO SOBRE LA HIDROLISIS DE LA AMELOGENINA.

Journal Dent

4.1.1 INTRODUCCION :

La amelogénesis es un complejo proceso que está regulado por el órgano del esmalte . El mencionado órgano del esmalte consiste en varios tipos de células , incluidos los ameloblastos , los cuales son células columnares grandes que permanecen en contacto con el esmalte durante todo su desarrollo . Los ameloblastos pasan a través de una serie definida de alteraciones morfológicas conocidas como etapas de desarrollo de diferenciación , secreción , transición y maduración . Durante la etapa secretoria , los ameloblastos , sintetizan y segregan proteínas de la matriz del esmalte mientras se forman cintas de esmalte mineral . Es durante esta etapa que la matriz del esmalte mantiene un pH neutral el cual se ha medido entre pH 7.0 y pH 7.4 . El mineral del esmalte es muy similar a la hidroxiapatita Ca3OH(PO4) , pero también contiene bajos porcentajes de carbonato , sodio y magnesio . Cada etapa sucesiva de desarrollo está asociada con una disminución progresiva en el contenido de proteínas del esmalte en formación y con un incremento relacionado en su contenido mineral . El esmalte completamente maduro tiene mas del 95% de su peso de contenido mineral . Entonces , el esmalte en desarrollo es tejido dinámico que empieza desde un material blando (como queso) antes de lograr su completa maduración en la forma de un tejido duro .

La amelogenina es la proteína mas abundante presente en el tejido en formación , y su secuencia aminoácida esta altamente conservada en las especies mamíferas .

La amelogenina es hidrolizada por enzimas que están presentes dentro del esmalte en formación . El polipeptido de longitud completa está restringido dentro de 40 m de la superficie del esmalte en desarrollo , en tanto que los productos del desdoblamiento proteolítico se observan atraves de todas las capas del esmalte . Los productos de desdoblamiento de la amelogenina tienen propiedades bioquímicas diferentes de aquellas de las proteínas intactas tales como una menor solubilidad y una afinidad disminuida con los cristales de hidroxiapatita . Esto sugiere que la función de la amelogenina intacta es separada y distinta de los dos productos de desdoblamiento . La localización de la amelogenina intacta relacionado con la capa superficial del esmalte es corroborada por resultados que muestran que la amelogenina hidroliza proteínasas en cuestión de horas después de su secreción entre la matriz del esmalte.

Los resultados de estudios inhibidores han clasificado las enzimas presentes en el esmalte en desarrollo como una serie de proteinasas , y metalloproteinasas . Una matriz metalloproteinasa única (MMP) llamada enamelisina fue clonada del órgano del esmalte de los porcinos . Y recientemente , el homologo enamelisina humana (MMP - 20) fue clonado de la papila dental . La familia MMP está caracterizada por una estructura de dominio común que incluye una señal péptida , un propetido y un dominio catalítico conteniendo un sitio para unión de zinc . Excepto para matrilysina , la cual es la mas pequeña de las MMP , las metalloproteinasas de la matriz contienen un dominio como - hemopexin COOH- terminal . Las gelatinases y membranas tipo MMPs contienen secuencias adicionales . MMPs se hace catalíticamente activo en presencia de calcio luego de la remoción de los propetidos . Las MMPs juegan un importante papel en la remodelación y desarrollo del tejido normal y están activas durante la cicatrización de las heridas , involución uterina y mamaria , angiogénesis y remodelación ósea .

Si bien la enamelisina tiene un Mr que es similar al de las stromelisinas y colagenasas , no es miembro de ninguna de estas dos clases de MMPs . La enamelisina no contiene sitios de glicosalacion N vinculados y su transcripción hasta ahora se ha encontrado solo en tejidos asociados con dientes en desarrollo . La enamelisina está regulada por el desarrollo y su transcripción se ha identificado tanto en el órgano del esmalte como en tejidos de la papila dental de los dientes en desarrollo de los porcinos . Aquí nosotros identificamos tres tipos de células responsables de reproducir transcripción de la enamelisina y demostramos que primera vez que la enzima esta presente dentro de los dientes en desarrollo . Adicionalmente , caracterizamos la relativa capacidad de la enamelisina recombinante (rMMP - 20) para hidrolizar la amelogenina recombinante bajo condiciones de variados pHs y concentraciones de iones calcio .

 4.1.2 MATERIALES Y METODOS

Hibridación In Situ.

Un fragmento 238 - bp cDNA codificando una porción dominio como - hemopexin enamelisina del porcino fue clonada en el vector pCR - Script SK y fue mineralizado con las enzimas de restricción apropiadas para la producción sense y antisense . Un molar M2 de un cerdo de seis meses fue fijado con paraformaldehido al 4% en una solución salina fosfato amortiguada de pH 7,0 y descalcificado con EDTA al 10% a un pH de 8,0 . El molar fue embebido en parafina y se prepararon secciones de 5,0 - m . Después de la desparafinación , los especímenes fueron tratados con proteinasa K (10 - m / mL) durante 15 minutos a la temperatura ambiente y la fosfatasa alcalina endógena fue inactivada mediante la adición de 0,2 N de HCl . Las secciones de los tejidos fueron hidrizadas con una solución conteniendo formamina 50% , 10 mM Tris - HCl (pH 7,6) , 200 - m / mL tRNA , 1 x solución Denhardt , 10% dextran sulfato , 600 nM NaCl , 0,25% SDS y 1 nM EDTA a 50°c durante 16 horas en una cámara humificadora . Los especímenes fueron lavados en 2 x SSC conteniendo formamide 50% y 55 grados centígrados durante 30 minutos y luego enjuagados a 47°c durante 10 minutos en TNE 10 mM Tris - HCl , pH 8,0 , 500 mM NaCl , 1 nM EDTA , Transcripciones no hibridizadas fueron digestadas con 20 m/ mL. RNAse A en TNE a 37°c durante 30 minutos . Nuevamente lavados en TNE a 37°c durante 10 minutos una vez con 2x SSC a 50°c durante 20 minutos y finalmente dos veces con 0,2x SSC a 50°c durante 20 minutos . Los teñidos de hibridazación in situ se realizaron por medio del sistema Geniun Detection . Transcripciones de enamelisina fueron detectadas con un anticuerpo digoxigenina conjugada para fosfatasa alcalina de acuerdo a las instrucciones del fabricante .

Western blots y simografia seguida por Western blotting .

Incisivos sin erupcionar fueron extraídos de las mandíbulas de porcinos y se raspó una capa aproximadamente 30 m de esmalte exterior de la superficie labial de 70 dientes de acuerdo a los métodos previamente descritos . Aproximadamente una muestra de 60 mg de esmalte fue disectada y homogenizada en 6 mL de 50 mM solución amortiguadora carbonatada (pH 10,8) previamente a la centrifugación . Se recolectó el sobrenadante y se recentrifugó . Este proceso se repitió tres veces . Los sobrenadantes fueron conjugados y concentrados a 0,6 mL por ultrafiltración con una membrana Amicon YM - 3 .

Se produjo antisuero de conejo contra residuos 334 - 348 y 462 - 482 de las secuencias aminoácidas deducidas de enamelisis como previamente se describió . Cada péptido fue vinculado a amino - cellulofine para purificación del antisuero por cromatografía por afinidad.

Western blots fueron realizados por la adición del esmalte extractadas a un gel con carga amortiguadora (1% SDS , 1 mM EDTA , 25% glicerol , 0,01 M Tris - HCl ) pH 8,0 el cual fue entonces cargado con un gel acrilamide . Se realizó la electroforesis bajo condiciones no reductoras de acuerdo al método de Maemmil (1970) . Las proteínas fueron transferidas a membranas GVHP . Las membranas fueron inmunoteñidas por el método complejo biotin - Avidin . Los anticuerpos antipeptidos fueron usados a concentraciones de 1 m / 10 mL .

La simografia se realizó de acuerdo al método de Heussen y Dowdle luego de electroforesis y remoción del SDS , el gel fue incubado durante 30 minutos en el amortiguador a 37°c . Luego el gel fue electrotransferido a una membrana GVPH , y la membrana se sometió a Western blotting con antisuero purificado a concentraciones de 4,0 m / 10 mL . Después de electrotransferido , el gel se teñía con Coomassic Brillant Blue de tal manera que pudiera visualizarse zonas de actividad proteolítica . No toda la alfa - caseina transfirió la membrana , entonces bandas negativas representativas de la degradación de la caseina fueron visibles luego de coloreado el gel .

4.1.3 INMUNOHISTOQUIMICA.

Marranitos de cerca de 3 kg fueron sometidos a perfusión con paraformaldehido 4% y glutaraldehido 1% en solución amortiguadora de fosfato de sodio , pH 7,4 . Brotes de dientes molares deciduos fueron disectados de descalcificados con EDTA 10% (pH 7,4) a 4°c durante cerca de dos semanas . Los especímenes se

lavaron en el amortiguador fosfato , deshidratados en foramide - dimetilk - NN graduado y embebidos en glicol metacrilato a -20°c . Se cortaron secciones ultradelgadas , montadas sobre una rejilla de níquel y coloreadas con el método colorante Silver imnunogold .

Expresión bacterial de rMMP - 20 porcino .

Volúmenes de medio litro NCZYAmp inoculados con células Azul - XL1 colonizando la expresión construida fueron creciendo a 37°c en sacudidas orbitales hasta que el OD a 550 nM alcanzara 1,0 IPTG fue entonces añadido a una concentración final de 0,1 mM y los cultivos crecieron por el tiempo de dos horas . Las células inducidas fueron sometidas a centrifugación , re - suspendidas en 6 M de guanidina - HCl , y sonicadas ( es decir sometidas a la energía producida por ondas sonoras ) . El resultado bacterial fue centrifugado y el sobrenadante pre - filtrado con un filtro de 0,2 micrones y aplicado a una columna agarose NTA . La columna se lavó y la enamelisina recombinante fue removido con el uso de un solvente con 8M de urea y 100 mm de imidazole.

Simografía de rMMP - 20 con un sustrato amelogenina recombinante.

La amelogenina recombinante Murine fue purificado como previamente se ha descrito y co - polimerizado en gel poliacrilamide 12% conteniendo SDS 0,1 % Enemelisina liofilizada se mezclo con una muestra amortiguadamente cargada (60 mM Tris - HCl (pH 8,8) , sucrosa 30% , SDS 7% , 0,02 mg/mL de azul bromofenol) e incubado a temperatura ambiente durante 10 minutos . La electroforesis se realizó a una corriente constante de 20 mA por gel . Luego de la electroforesis el gel fue lavado dos veces durante diez minutos en 50 mL de una solución Tritón X-100 de 2,5% en 100 mM amortiguador Tris - HCl (pH 8,0) Los geles fueron incubados de 16 a 24 horas a 37°c en 50 mM amortiguador Tris - HCl (pH 8,0) conteniendo 10 mM CaCl2 . Se colorearon entonces con una solución Coomassie Brilliant Blue (CBB) R - 250 ( 0,23% CBB r - 250 , ácido acético 5,8 % y metanol 30% ) por 20 minutos y decolorada con metanol 10% y ácido acético 10% hasta observar bandas claras de hidrólisis de amelogenina .

4.1.4 RESULTADOS

Localización de la expresión enamelisina mRNA..

Nuestra primera meta fue la de identificar los tipos de células asociados con los dientes que fueron responsables de la expresión de enamelisina . La hibridación in situ se realizó en secciones muy delgadas del molar M2 desmineralizado de un cerdo de seis meses . El molar M2 es el segundo molar porcino según lo definió Robinson . El esmalte presente sobre el molar unerupcionado estaba en la ultima etapa secretoria o de transición temprana de desarrollo . El mensaje enamelisina fue prevalente en las células ameloblastos del órgano del esmalte como se observa por la intensa coloración en la prueba RNA antisense ( figura 1. a ) La perdida perifolicular de tejido conectivo fue negativa para la expresión enamelisina . El uso de la prueba RNA senseno mostró una coloración significativa de las células amelobastos o tejido que las rodea ( fig 1. b) . Cuando se examinaron células de la papila dental , la prueba antisense reveló que las células odontoblastos expresaban fuertemente enamelisina . ( fig 1. c) No se vio ninguna coloración cuando se uso la prueba sense ( fig 1. d) Entonces las células asociadas a los dientes a las cuales producen la mayor cantidad de mRNA amelisina fueron los ameloblastos del órgano del esmalte y los odontoblastos de la papila dental . Ambos tipos de células están en contacto con su respectivos tejidos mineralizantes .

4.1.5 DISCUSION

Usando las pruebas RNA enamelisina específicas y utilizando antisueros que detectan enamelisina del porcino , nosotros demostramos por primera vez que la enamelisina es producido por los ameloblastos , y que la enamelisina es secretada de los ameloblastos en el desarrollo del esmalte.

También se demostró que rMMP - 20 logra la máxima actividad enzimática para un sustrato de amelogenina recombinante bajo condiciones de elevado calcio ( 10 mM ) y pH neutral . Aunque la enamelisina humana previamente había sido clonado , no fue posible obtener la cantidad de esmalte humano inmaduro necesaria para terminar estos experimentos . La alternativa porcina fue la mejor elección , dado que su esmalte dental está bien descrito. Los resultados de la hibridación in situ confirmaron resultados mostrando que el mensaje enamelisina estaba presente en el órgano del esmalte y en la papila dental de los dientes porcinos en desarrollo . Estos resultados identificaron los ameloblastos del órgano del esmalte y los odontoblastos de la papila dental como las células tipo responsables de la transcripción de elevados niveles del mensaje enamelisina . Dado que los ameloblastos están en contacto con el esmalte en formación , nos preguntamos si la proteína enamelisina fue secretada en el esmalte en desarrollo .

Los resultados de las pruebas Western blor , simografía seguida por Western blotting e inmunohistoquimicos demostraron que la enamelisina estaba presente dentro de la capa superficial ( 30 m de profundidad ) del esmalte secretorio ( fig 2-4 ) Los resultados inmunohistoquimicos revelaron que la enamelisina estaba localizado a vesículas secretorias dentro de los ameloblastos , y , basados en la distribución de la enamelisina dentro del esmalte en formación , parece que la enamelisina fuera liberada en la cara secretoria del proceso de Tomes . (fig 4) .

Dado que la enamelisina no contiene sitios de glicosilacion N - vinculados , las diferencias entre bandas 46 - Kda (fig 2) probablemente no fueron debidas a diferencias en glicosilación .

Aunque no puede descartarse la posibilidad de glicosilación 0 - vinculada , el Mr predicho del zymogen fue 51,9 kDa con un punto isoeléctrico (pi) de 8,93 , mientras que el Mr predicho para la enamelisina activo fue 42, 5 kDa con un pi de 6,34 . Entonces , el predicho Mr , basado en traslación conceptual de formas pro y activas de enamelina están de acuerdo con los resultados Western blot . Es entonces probable que las bandas 46 - kDa y 41 - kDa de las figuras 1 y 3 correspondan al zimogen y formas activas de enamelisina , respectivamente .

El Western blot demuestra también la presencia de bajas bandas Mr ( figura 3 líneas 2 y 3). Previamente se demostró colagenasa activa (MMP - 1) para sufrir un proceso de fragmentación autoproteolíca en diferentes sitios dentro de la región que conecta el dominio catalítico con el dominio como - hemopexi . Dado que ambos antisueros AbS1 y AbS2 fueron elevados contra peptidos presentes en el dominio como hemopexin de la enamelisina , estas bajas bandas Mr probablemente representen productos de desdoblamiento enamelisina terminal COOH resultantes de autoproteolisis . Esto podría explicar las bajas bandas Mr observadas sobre los simogramas de las figuras 5 y 6 . Estas bandas Mr probablemente resulten de un dominio catalítico rMMP - 20 que ha sido desdoblado como hemopexin terminal COOH .

Nótese que a diferencia de Western blot y simogramas de esmalte extraído (figuras 2 y 3) no se observó doble banda de 46/41 kDa sobre los simogramas que evaluaban la actividad de rMMP - 20 ( figuras 5 y 6) Las mayores bandas sobre los simogramas de las figuras 5 y 6 fueron aproximadamente 55 kDa ,el cual fue el tamaño esperado para fusión de la proteína rMMP - 20 (pro - rMMP- 20 mas el tag His) El componente SDS del procedimiento simográfico previamente había demostrado desalojar el propetido del dominio catalítico , creando una activa pro - enzima . Nosotros especulamos que se requiere una enzima diferente y distinta para desdoblar el propectido enamelisina previamente a su activación in vitro . Entonces , esta enzima podría estar presente dentro de la matriz del esmalte pero podría no estar presente en las preparaciones rMMP - 20 altamente purificadas.

La amelogenina intacta previamente había sido localizada dentro del esmalte recientemente formado a una profundidad de aproximadamente 40 m , mientras que sus productos de desdoblamiento proteolítico estuvieron localizados a través del esmalte . Aquí nosotros demostramos que la enamelisina está también presente en la cara superficial del esmalte en formación (fig 4) y puede , por tanto , estar involucrado en el procesamiento de amelogenina . Si bien la enamelisina posee una señal peptida , este no fue inmonulocalizado para el ER (fig 4) . Las vesículas secretorias contienen una alta concentración de proteínas para secretar . En contraste , ER contiene niveles bajos y estables de proteínas recientemente trasladadas . Entonces , las relativamente bajas concentraciones de enamelisina presentes en ER pueden explicar porque no pueden detectarse mediante técnicas inmunohistoquimicas .

Durante el estadio de desarrollo , el esmalte dental ha demostrado alternar entre un rango de pH de 7,2 a 6,2 . Varias investigaciones previas han usado simografia para evaluar los efectos de los diferentes pH´s y concentraciones del ion calcio sobre la relativa proteolítica de proteínas extraídas del esmalte . Se uso la técnica de simografía porque es sensitiva y porque separa las enzimas de acuerdo a su Mr . Por lo tanto para comparar nuestros resultados con los de investigaciones previas nosotros elegimos utilizar la simografía para la relativa actividad enzimatica de la enamelisina bajo condiciones de variados pH y concentraciones del ion calcio .

Usando proteínas e inhibidores y simografia , Overall y Limeabck (1988) fueron los primeros en mostrar la presencia de metalloproteinasa (62 a 130 kDa gelatinases) en el esmalte dental en desarrollo de los porcinos. Desde entonces Tanabe y otros, caracterizaron una enzima 78/76 kDa con actividad hidrolitica amelogenina la cual no fue completamente inhibida por la presencia del quelador calcio EDTA . Moradian y sus colegas también caracterizaron en 1994 , una metalloproteinasa EDTA - inhibido 68/62 kDa dele esmalte de bovino la cual demostró desdoblar la amelogenina . Entonces varias metalloproteinasas están presentes en el esmalte en formación , cada una de las cuales posee diferentes preferencias de substrato y optimo pH . La misma situación se presenta dentro de la dentina en formación , dado que varia metalloproteinasas Ca2+ dependientes han sido localizadas dentro de este tejido . Si bien hasta la fecha no se ha demostrado que la enamelisina esté presente en la dentina , nosotros ahora sabemos que éste es transcrito por odontoblastos los cuales están adyacentes a la dentina en formación.

Nuestros resultados fueron los más consistentes con los estudios simograficos de Smith y otros (1996) quienes examinaron proteínas extraídas del esmalte de rata . Los simogramas mostraron correspondencia con las bandas 46/41 kDa observadas en este estudio (fig 1 línea 1) . También como se demuestra en el presente estudio (fig 5) la proteína del esmalte de rata mostró una actividad caseinolítica que era mayor que su actividad gelatinolítica . El 46/41 kDa del esmalte de rata parece estar asociado con una Mr baja de aproximadamente 30 kDa , la cual también pudo observarse sobre los simogramas para rMMP - 20 (figuras 5 y 6) .

Concluimos que la enamelisina es secretada por los ameloblastos entre la matriz del esmalte durante la etapa secretoria de desarrollo y que el pH neutral de estos tejidos permite una optima actividad de la enamelisina .

Dado que los odontoblastos de la papila también expresan altos niveles de enamelisina , nosotros creemos que la enamelisina puede estar involucrada en el proceso de formación de la dentina . Entonces , la enamelisina puede jugar un importante papel en el desarrollo temprano de los dientes al crear productos de desdoblamiento de proteínas que son necesarios para una apropiada formación del esmalte y la dentina.

4.2 LA SUCESIÓN DE LONGITUD LLENA, LOCALIZACIÓN Y CROMOSOMAL QUE TRAZAN DE AMELOBLASTOMA

The Journal of Biological Chemistry

El diente mamífero es una estructura especializada que desarrolla una serie de interacción de mesenchymal de epithelial recíproca que culmina en la formación de tres tejidos mineralizados diferentes sin embargo: esmalte, dentina, y cemento. El diente ha mantenido un valioso sistema ejemplar entendiendo regulación del gen específica, morfogenesis, y mineralización. El esmalte es que un epitelial oral derivó tejido mineralizado, mientras que la dentina y cemento son formados por ectomesenchyme cresta derivado nervioso craneal. Este ectomesenchyme cresta derivado del nervioso craneal se deriva del neuroectodermo de rhombomere 2 del hindbrain vertebrado. Como en hueso, la matriz del premineralizado de dentina y cemento contiene una matriz rica en colágeno que se mantiene a lo largo del tejido maduro. Sin embargo, el esmalte difiere de estos otros tejidos del mineralizer de dos maneras del importan: 1) la matriz de esmalte epithelio derivada no contiene tipo I de colágeno; y 2) la matriz orgánica de esmalte está esencialmente perdida durante la maduración del tejido, produciendo un tejido que está más de 98% mineral en la forma de hidroxiapatita.

En la amelogénesis, la formación de esmalte del diente, es dividido en las fases de desarrollo discretas. Siguiendo una fase del presecretoria en el cual el epitelio de esmalte interno recibe señales de desarrollo del papillae dental, el epitelio de esmalte interno diferencia en el ameloblasto secretorio. La matriz de esmalte, secretada por el ameloblasto, está compuesta de dos clases de tipos de la proteína las amelogeninas y las enamelinas. Las amelogeninas son proteínas hidrófobas ricas en prolina, histidina, y ácido del glutamico y comprenden aproximadamente 90% de la matriz de esmalte es debido al RNA mensajero.

El siguiendo 10% de la matriz de esmalte se compone de enamelinas agrio y otro no las proteínas de las amelogeninas como amelogeninasa. Una vez el espesor lleno de matriz de esmalte se forma, los morfological significantes y los cambios funcionales ocurren dentro del ameloblasto cuando atraviesa la transición, maduración, y las fases proteccionista de desarrollo. Así, el diente en vías de desarrollo es un único órgano mineralizando y proporciona un sistema de desarrollo interesante.

Aunque unos dientes que se han identificado genes específicos, no se definen bien los mecanismos precisos del morfogenesis del diente, mineralización y el patofisiologia de esmalte heredado y defectos deala dentina. Nosotros hemos comenzado un proyecto del genome por consiguiente con una última meta de identificar nuevos genes involucrada en formación del diente que puede ayudar explique los mecanismos de odontogenesis. Nosotros escogimos usar el incisivo de la rata continuamente haciendo erupción como un sistema ejemplar, porque la sucesión de desarrollo completa de odontogenesis puede analizarse en un solo diente. Como un acercamiento inicial, nosotros construimos una biblioteca del cDNA unidireccional que no calcificó la porción de incisivo de 3 ratas viejas en 4 semana, clones de la secuencia, y clasificó sucesiones basadas en su homologia para saber genes. Un clon determinado Y224 era el gen de la novela más abundante expresado y era parcialmente sucesión. Aquí, nosotros informamos el secuencializacion de longitud lleno, célula la expresión específica, y paterno de localización de proteína de un ameloblasto recientemente descritos gen específico que nosotros hemos designado ameloblastina.

4.2.1 PROCEDIMIENTOS EXPERIMENTALES

Sucesión de ADN análisis ambas cuerdas de la inicial Y224 inserción del cDNA sea secuencializada por el dideoxynucleotido encadene método de la terminación que usa la versión del secuenciador 2.0 ADN (Aplicó Biosystems, modele 370A). Se sintetizaron cebadores del olionucleotido específicos en un biosistemas aplicados modele 380B sintetizador de ADN.

La proteína de Recombinante y producción del anticuerpo. Una proteína del recombinante fue hecha por subclonacion de un fragmento de Y224 que corresponde a +613 a +1134 pares de la base en un vector de la expresión que pone en código seis residuos del histidina en el término de N de la proteína del recombinante (pQE30, Qiagen). El plasma del recombinante (pKQE-17) se transformó en competente M15(pREP4) las células y la proteína eran inducido con isopropyl-b -s -thiogalactopyranoside. La proteína del recombinate que usó se purificó un níquel-nitrilotriacetic ácido-agarose la columna de afinidad (Qiagen).

Se hicieron anticuerpos de Polyclonal contra pKQE-17 usando procedimientos normales. Nueva Zelanda se inocularon conejos Blancos con 500 ug de pKQE-17 en un volumen igual de adjuvant de Freund´sincomplete (Duncroft Inc.). Se realizó el aislamiento de IgG de suero usando una proteína Un-agarose la columna (la Affi-gel TRAZA II, Bio-Rad).

las sondas usaron para la Hibridación del situ. El Y224 clon era linearized por BamHI y Xhol para el antisense y producción de sonda de sentido, respectivamente. Digoxigenin-UTP-etiquetado, solo-strandantisense y sentido que las sondas de ARN fueron preparadas por T7 polymerase de ARN y T3 polymerase de ARN, respectivamente, usando un ARN que etiqueta equipo (Boehringer Mannheim).

En hybridation del Situ.

Para en hybridation del situ, se anestesiaron 3-4 ratas del sprague-dawley semana-viejas con hydrochloride del ketamine (sigman) y perfused con 4% el paraformalaldehyde en fosfato-buffered salino (pH 7.0) a través del ventricule izquierdo, se cortaron mandíbulas, incluso los incisivo, y decalcified en 10% EDTA (pH 8.0) durante 10 días y empotró en parafina. En hybridation del situ el perfomed estaba en 5 secciones del um. La hibridación de secciones del tejido era perfomed en un hybridizationsolution (50% el formamide, 10 mm Tris HCl (pH 7.6), 200 tRNA del ug/ml, 1 * la solución de Denhardt´s, 10%dextran sulfato, 600 mm NaCl, 0,25% SDS, y 1 mm EDTA)at 50 C para 16 h en una cámara humedecida. Se lavaron diapositivas secuencialmente en 2 * SSC que contiene 50% el formamide a 55 C para 30 min y entonces enjuagó a 37 C para 10 min en TNE (10 tRIS del mm HCl (pH 8.0), 500 mm NaCl, 1 mm EDTA. Se digirieron transcripciones de Unhybridized con 20 ug/ml RNase UN (Sigma) en TNE a 37 C para 30 min. Las diapositivas se lavaron agan en TNE a 37 C para 10 min, una vez con 2 * SSC a 50 C para 20 min y finalmente dos veces con 0.2 * SSC a 50 C para 20 min. Se descubrieron transcripciones específicas con anticuerpo del phosphatase alcalino anti-digoxigenin-conjugado (Boehringer Mannheim).

4.2.2 MÉTODOS DE IMMUNOHISTOQUIMICA

Las secciones de parafina eran deparafinized y hidrataron antes del inactivation de peroxidases endógeno adiós 3% el peróxido de hidrógeno para 10 min. Las secciones se bloquearon con suero de la cabra normal, y el immunolabeling de la tres-capa fue realizado. Para el immunolabeling, un antígeno afinidad-purificó que anticuerpo mono-específico levantado contra la pKQE-17 proteína del recombinant fue usado. las secciones se incubaron con un biotinylated que el anticuerpo secundario seguido por streptoavidin-peroxidase. Inmunolocalization fue visualizado por diaminobenzidine (HistoMark, Kirkegaard y laboratorios de Perry). Como un mando negativo, el anticuerpo contra pKQE-17 era preabsorbed con la proteína de fusión y se usó en el mismo procedimiento del immunostaining descrito anteriormente.

4.2.3 AISLAMIENTO DE ARN Y ANÁLISIS

Total que RNAfue extraido de tejidos que usan un método del ácido-guanidinium-phenol-cloroformo. Se guardaron pelotillas de ARN a -80 C hasta analizó. Diez micrograms de ARN total estaban separados en un 1% el agarose, 1 m formaldehído gel y transferido por acción del capilar a las membranas de Nilón (Magna Nt, Separaciones de la Micra Inc.). Un cDNA de cuerpo entero (Y224) la sonda se etiquetó dCTP por un método del oligonucleotide azar-imprimado y se hizo híbrido a 42 C.

4.2.4 MAPA CROMOSOMAL DEL GEN DE AMELOBLASTINO DE RATÓN

El gen del ameloblastin fue trazado por análisis de dos pone cruces del multilocus: (NFS/N o C58/J * el Mus musculus musculus) * M, m. musculus y (NFS/N * el spretus del mus) * spretus de M. o C58/J. Se han tecleado DNAs de estos croses para más de 850 sitios, incluso el cromosoma 5 Equipo de los sitios (oncogene del equipo), Afp (un-fetoprotein), Ibsp (sialoprotein del hueso), y Pdeb (phophodiesterase B) como describió previamente. Se guardan datos de estas cruces y se analizan usando el SITIO del programa desarrollado por C. C. Buckler (Narional Institutes de Salud, Bethesda, MD).

4.2.5 RESULTADO

Nosotros construimos una biblioteca del cDNA unidireccional previamente de los tejidos no-calcificados de incisivo de la rata y parcialmente el sequenced la 5 porción de las cuerdas codificando de aproximadamente 400 clones al azar seleccionados. El homology de la sucesión investiga a través de la base de datos de GenBank y PIR proteína base de datos reveladas que la mayoría de los clones (aproximadamente 56%) representó genes previamente no identificados. Para identificar nuevos genes involucrados en desarrollo del diente que nosotros hemos enfocado primero frecuentemente en el mos expresados genes de esto la población del cDNA previamente no identificada.

4.2.6 EXPRESIÓN TEJIDO-ESPECÍFICA DE Y224.

El análisis del borrón norteño de ARN total extrajo del bazo de las ratas, rompa la cabeza, mire, la glándula salival, corazón, thymus, pulmón, kidneu, y incisivo revelaron ese mRNA para Y224 fue descubierto por análisis del borrón Norteño en otros tejidos mineralizados como boone y cartílago (datos no mostrados). Se identificaron dos transcripciones a aproximadamente 2.0 y 1.6 kg. Un modelo restringido idéntico de expresión del mRNA se observó en tejidos del ratón.

Localización de Y224 que usa en Hibridación del Situ.

Nosotros examinamos el modelo de la expresión de clon que Y224 mRNA se limitó a la capa de célula de ameloblast. Se observaron niveles especialmente altos de expresión en el citoplasma del distal de ameloblast secretorio. El incisivo del ratón mostró expresión idéntica que usa el antisense de la rata la sonda de ARN (datos no mostrados). Subsecuentemente en hibridación del situ mostrado niveles altos de expresión de Y224 en ambos en células del linaje del ameloblast, nosotros nombramos su ameloblastin de producto de gen y más allá caracterizamos el cDNA y estudió la localización de su producto.

4.3 INTERACCIONES PROTEINA - A - PROTEINA : CRITERIOS DEFINIENDO LA ORGANIZACION DE LA MATRIZ ORGANICA DEL ESMALTE.

Journal dent

4.3.1 INTRODUCCION

El entendimiento o la comprensión del papel fundamental de las proteínas del esmalte durante la biomineralización de éste , es una meta avaramente buscada . El esmalte se forma de modo completamente extracelular , coincidiendo con la remoción de sus proteínas , y con su remplazo por cristales de hidroxiapatita carbonatada . La organización de la matriz orgánica del esmalte , su desorganización por las proteasas y el crecimiento de la fase mineral a expensas de la fase orgánica implican que la formación del esmalte es un fenómeno biológico extremadamente complejo el cual opera como consecuencia de mecanismos de control sincronizados y estrechamente regulados .

Hasta la fecha , un papel esencialmente fisiológico para una proteína del esmalte durante su formación se ha demostrado solamente para la amelogenina . En el caso de la amelogenina , los humanos afectados por un defecto hereditario del esmalte conocido como amelogenesis imperfecta presentan un defecto en el gel amelogenina localizado en el cromosoma - X . De este defecto resulta la expresión reducida o eliminada de la amelogenina , proporcionando un enlace genético para la amelogenina como un componente esencial de la matriz del esmalte . Así mismo experimentalmente se han demostrado defectos similares en la formación del esmalte en animales cuando los niveles de la proteína amelogenina son dramáticamente reducidos cuando el mensajero amelogenin RNA fue tomado como objetivo para el desdoblamiento por medio de ribozomas cabeza de martillo , corroborando entonces el papel requerido para las proteínas amelogeninas durante la organización de la matriz.

La ameloblastina , conocidas también como amelinas o sheathlin , es una proteína extracelular que se expresa en niveles elevados de ameloblastos secretorios y pos secretorios . Todavía no se conoce el papel preciso de la ameloblastina durante la formación de la matriz orgánica del esmalte. Estudios realizados por Mac Dougall y sus colegas han implicado un papel esencial a la ameloblastina durante la formación del esmalte en experimentos de mapeo genético los cuales colocan la gel ameloblastina en la región critica de forma autosomal - dominantes de amelogenesis imperfecta . Experimentos de hidrización in situ localizan también al mensajero ameloblastin RNA para células epiteliales adyacentes a la superficie de la dentina recientemente depositada a lo largo del tronco de la raíz y para células enclavadas en el cemento celular . Hace ya algunas décadas , Slavkin y Boyde (1974) propusieron un origen epitelial para el cemento , y con el clonamiento de ameloblastinas , sus predicaciones de productos del gen epitelial dentro del cemento han sido comprobados . Adicionalmente a su papel en la formación del esmalte , identificación de la expresión ameloblastina durante la cementogenesis sugiere que este puede ser también un gen candidato para formas heredadas de disturbios en la diferenciación del cemento.

Hasta la fecha no se ha probado de manera concluyente el papel esencial del tuftelin en la formación de la matriz orgánica del esmalte . El gen tuftelin o de la tuftelina , es altamente conservado a través de la evolución vertebrada . La tuftelina permanece fuertemente implicado en la formación del esmalte normal y en la pantogenesis de defectos del esmalte en virtud de las características físicas y químicas de esta macromolécula acídica y su papel potencial en indicar la formación de cristales.

El esmalte se forma completamente extracelular, implicando que los constituyentes proteínicos del esmalte deberán ser capaces de organizarse en una matriz proteínica orgánica competente que dirija su remplazo por la fase inorgánica . Las características y las propiedades físicas y químicas de la matriz extracelular del esmalte han sido conocidas durante largo tiempo . Las recientes técnicas de biología molecular que ahora disponemos nos han proporcionado herramientas experimentales para su ilustración . Por ejemplo , el soporte experimental para la auto - organización de las proteínas del esmalte proviene de los experimentos in vitro en los cuales se ha demostrado que la amelogenina M180 bacterialmente expresado altamente purificado se organiza en estructuras que parecen nanosferas . La corrobación del concepto de nanosferas generadas in vitro proviene de la observación que también pueden observarse estructuras nanosféricas ( microscópicas ) durante la formación in vitro del esmalte. En 1989, Fields y Song publicaron un método , referente a al sistema híbrido ;dos levaduras , para examinar interacciones proteína - proteína en levaduras eucarióticas huésped . Este método usa actividad - galactosidasa para indicar la avidez de interacción entre dos proteínas y han sido ampliamente utilizado para identificar interacciones proteína - proteína ocurridas bien dentro del núcleo o bien dentro del citoplasma de la célula . Nosotros razonamos que el ensayo de dos híbridos podría a su vez ser una herramienta valiosa para estudiar las propiedades de la organización de la matriz extracelular por las proteínas del esmalte . Nuestros hallazgos se relacionan con las propiedades de organización proteína - esmalte para posibles papeles de la amelogenina ,tutfelin y ameloblastina durante la formación del esmalte . Estos resultados no proporcionan funciones especificas para ninguna de las proteínas conocidas del esmalte , si no más bien nos proporcionan evidencia in vitro de que existen limitaciones a las interacciones proteína - proteína que definen la organización de la matriz extracelular del esmalte .

Los resultados del presente estudio sugieren que la capacidad de amelogenina y tuftelin para dirigir su propia organización extracelular durante la biomineralización del esmalte es una importante etapa en la producción orgánica competente ,que dirija su remplazo por la fase mineral.

4.3.2 MATERIALES Y METODOS.

Construcción de plasmido.

En otro articulo , se publicó una completa explicación del ensayo híbridos - dos levaduras y del plasmido madre ( pPC97 y pPC86 ) usados en este estudio . Brevemente , el pPC86 el GAL4 plasmido dominio activado. Los polivínculos del pPC97 y pPC86 son idénticos . La completa región codificada de amelogenina y una isoforma de la amelogenina ,la proteína amelogenina rica en leucina o LRAP o tuftelin o ameloblastina fueron amplificadas de un plasmido por métodos estándares y clonados en el plasmido pPC97 y pPC86, como se describió en el mencionado artículo.

Los primers para la amelogenina amplifican el cDNA correspondiente a los aminoácidos de 1 a 180 ( M180 ) y aminoácidos de 1 a 59 ( LRAP ) .Primers para tuftelin amplificada en cDNA correspondiente a aminoácidos de 1 a 139 y primers para ameloblastina amplifican el cDNA correspondiente a aminoácidos desde 1 hasta 422 ( incluida señal péptida ) o aminoácidos de 27 a 422 ( excluida señal péptida ) . El pre - pro líder de la amelogenina se ha omitido en este estudio en tanto que la señal de secuencia péptida de ameloblastina ( aminoácidos de 1 a 26 ) si se incluyo en este estudio . Los oligonucleotidos usados para PCR contienen sitios de restricción que permiten un ambiente eficiente para sub clonación del FNA generado ( tabla 1 ) . Nosotros obtuvimos DNA a lo largo de los sitios de clonación de cada plasmido para confirmar la correcta orientación y armazón del inserto cDNA .

Tabla 1. Oligonucleotidos usados para la construcción de GAL4 híbrido plasmido conteniendo las proteínas de la matriz del esmalte.

--------------------------------------------------------------------------------------------------

Amelogenin forward primer (Bam HI)

Amelogenin Reverse primer (Sac I)

Tuftelin Forwat primer (Bam I)

Tuftelin Reverse primer (Sac I)

Ameloblastin forwad primer (Sal I)

Ameloblastin forwad primer (Bgl II)

Ameloblastin reverse primer (Aat II)

TTCGGATCCCT.ATGCCCCTACCACCTa

TTAGAGCTCTTAATCCACTTCTTC

TTCGGATCCCC.ATGGTGTCCAGCCACTCA

TTAGAGCTCTAGTCCTCTGTCTGCC

GAGGTCGACA.ATGTCAGCATCTAAG

TTCAGATCTCC.GTGCCGGATTTCCT

TAAGACGTCAGGGCTCTTGGAA

--------------------------------------------------------------------------------------------

los sitios de restricción se subrayan , y un período indica el comenzar de la sucesión codificada.

La amelogenina , LRAP y tuftelin DNA fueron clonados entre el sitio Bgl II/Sac de cada vector híbrido y la ameloblastina DNA fueron clonados entre el sitio Sal 1 / Aat II ( señal peptida incluida ) del vector pPC86. Plasmidos híbridos positivos para antígenos - T p53 y SV40 fueron comparados a stratagene ( La jolia, USA) y los plasmidos híbridos para H-ras y CDC 25 fueron proporcionados por los doctores D Broeck y R Mosteller de la Universidad del sur de California.

Actividad b - galactosidase.

Ensayos filtrados fueron usados para evaluar la actividad  - galactosidase ,un parámetro que refleja directamente la fuerza de las interacciones proteína - híbrido . Se hicieron transformaciones de plasmidos dobles en el cultivo PCY2 de levadura .Se establecieron colonias de levaduras doblemente transformadas y tres colonias separadas fueron pasadas por papel de filtro y se les permitió crecer durante dos días en un medio seleccionado . Permeabilizamos las levaduras congelando el filtro impregnado de ellas en nitrógeno líquido y luego descongelándolas a la temperatura ambiente . El filtro se coloca en un segundo filtro empapado con una solución amortiguadora de fosfato a 0,1-M conteniendo 300 g/mL. Galactopyranoside 5 - bromo - 4 - cloro - 3 - indolyl -  - D - (X-gal) y mercaptanoetanol -  0.27%. Los filtros se dejaron desarrollar durante 48 horas un color azul , siendo este cambio de color de una interacción positiva.

Adicionalmente , se obtuvieron datos cuantitativos relacionados a la fuerza relativa de interacciones proteína - híbrido por medio de ensayo de cultivo (ONPG) .Usando este ensayo de cultivo líquido concurrentemente examinamos todas las combinaciones híbridas de construcciones y repetimos completamente el experimento en tres ocasiones distintas.

En cada ocasión se cuantificarón medidas espectrofotométricas contra construcciones de amelogenina procesadas de longitud completa interactuando consigo mismas (tabla 2) Se calculo el error estándar y la medida para cada combinación doble - Transformante (tabla 2) excepto para la lectura de H - ras interactuando con CDC25 , la cual mostró un color tan intenso que fue difícil establecer una lectura precisa .

4.3.3 DETECCIÓN WESTERN DE LAS PROTEÍNAS.

Para evaluar las interacciones negativas podrían deberse únicamente a la ausencia de proteínas objetivo , analizamos construcciones de ameloblastos en su capacidad para expresar fusión de proteínas . Usamos métodos publicados en detalle para la detección de proteínas . En resumen , las proteínas fueron recuperadas de células de levaduras transformadas con los plasmidos nombrados . Y cantidades equivalentes de proteínas por cada muestra fueron cargadas y solucionadas para tamaño por medio de SDS - PAGE 10% . El gel fue electrotransferido para membrana fluoruro polivinilidine (PVDF) , extensivamente bloqueada con albúmina 1% y suero de cabra 1% y ebitotobes ameloblastina detectados por el uso de anticuerpo policional de conejo fermentado contra ameloblastina recombinante a una dilusión de 1 :200 a temperatura ambiente durante toda la noche.

4.3.4 RESULTADOS

En la tabla 2 se presentan las interacciones entre tres proteínas de la matriz del esmalte clonadas - amelogenina (y LRAP) ,tuftelin y ameloblastina - así como las combinaciones positivas de control. Los datos presentados en la tabla 2 relacionan las fuerzas relativas de interacciones (cuando se comparar con amelogenina intacta intarectuando consigo mismo, con las cantidades grandes indicando mayor avidez ) y registrando por el ensayo de cultivo líquido para actividad  - galactosidase . Controles positivos fueron proteína supresora de tumores p53 co-transformada con el antígeno TSV40 largo y H - ras (tipo salvaje) co-transformado con la proteína CDC25 de Saccharomyces cerevisiae . Controles negativos involucran cada una de las construcciones híbridas proteína - esmalte cotransformadas bien con pPC86 ( para el híbrido pPC97 ) o pPC97 ( para los híbridos pP86 ) . Todas combinaciones negativas de control no tuvieron actividad - galctosiadase determinada por el ensayo de cultivo líquido.

El ensayo de levadura dos - híbridos fue realizado también sobre un filtro soportando tres colonias de cada combinación de construcción probadas y los resultados obtenidos fueron consistentes con los de ensayo de cultivo liquido . Un color azul se desarrolló dentro de la primera hora para la construcción H - ras co-transformada con la construcción proteína CDC25 , y sobre un período de dos horas para la construcción tuftelin co-transformadora dentro de si misma . El azul se desarrolló para la construcción de amelogenina M180 co-transformada consigo misma y para construcción p53 co-transformada con construcción antígeno - TSV40 largo, durante un periodo de aproximadamente ocho a diez horas . Un azul muy pálido para la construcción de amelogenina M180 co-transformada con la construcción LRAP estuvo presente después de 24 horas. No se desarrollo coloración azul después de las siguientes 24 horas para iteraciones involucrando ameloblastina o amelogenina co-transformados con tuftelin y estas combinaciones tuvieron que registrarse como resultados negativos . Las combinaciones negativas de control no desarrollaron color azul después de 48 horas.

La detección Western del epitope ameloblastina se logró por la fusión de la proteína ameloblastina producida por el plasmido pPC97 ( la cual incluía la señal de secuencia peptida ) ( figura 1 callejón 4 y figuras 2 callejones 2 y 49 ). El análisis Western no pudo demostrar un producto para la fusión proteína ameloblastina ( la cual incluye la señal peptida ) subcionada entre el plasmido pPC86 ( figura 1 ,callejón 3 ) , y por esa razón se preparó un segundo plasmido conteniendo ameloblastina el cual no incluyo la señal de secuencia peptida . la falla para detectar un producto proteíno - híbrido en levaduras previamente había sido observada . La falla para identificar la proteíno - híbrido no necesariamente significa que el producto gen ameloblastina - híbrido no éste presente . Para asegurar que la falla observada de ameloblastina para autoorganizarse y su falla para interactuar con ambos amelogenina o tuftelin fueron debidas a una propiedad intrínseca de la ameloblastina ( y no debidas a un híbrido - proteína inestable , nosotros realizamos interacciones ameloblastina usando solo aquellas construcciones que produjeron un producto híbrido identificable en el análisis Western . La detección Western de un epitote ameloblastina se logró para la segunda proteína fusión ameloblastina producida en el plasmido pPC86 ( figura 2 , columna 3 y 4) La ameloblastina construido en el vector pPC97 (incluyendo la secuencia líder ) se usó para probar interacciones con ambos amelogenina o tuftelin . Plasmidos construidos produciendo epitopes de ambos amelogenina M180 , LRAP , o tuftelin interactuaron con al menos uno de los otros plasmidos construidos , y , por esta razón se ha asumido la estabilidad de estas proteínas - híbrido dentro del nucleoplasma de las levaduras.

4.3.5 DISCUSION

El esmalte dental es un ejemplo bien reconocido de proteína - matriz - biomineralización mediana. Se ha considerado como un modelo útil a causa de sur relativa simplicidad a niveles celulares y de proteínas cuando se compara con las complejidades del hueso o la dentina . Las proteínas predominantes dentro de la matriz orgánica del esmalte son las amelogeninas y las enamelinas , de las cuales el tuftelin es el único miembro clonado de la familia enamelin.

Las proteínas amelogenina ,tuftelin y ameloblastina se expresan exclusivamente por células del órgano interno del esmalte y segregadas entre la matriz extracelular del esmalte en formación . La enfermedad genética conocida como amelogenesis imperfecta ha sido mapeada para el gen amelogenina en una cantidad de familias . El hallazgo de que los defectos en el locus amelogenin resultan en defectos en la organización de la matriz del esmalte no debe causar sorpresa , dado que regiones terminal - amino y péptido carboxyl - terminal recientemente han demostrado que interactuan uno con otro para facilitar que ocurra la auto organización amelogenina . Los resultados identificando propiedades de auto organización para amelogenina son también sustentados tanto en observaciones in vitro como in vitro acerca de que las amelogeninas se organizan en estructuras nanosféricas compuestas de cientos de molécula de amelogenina . Investigaciones adicionales sobre las propiedades de auto-organización de la matriz extracelular dele esmalte recientemente se han identificado para tuftelin . El tuftelin es un medio de la familia anionica de proteínas conocidas como las enamelinas, y más posiblemente similares a las proteínas anionicas arquetípicas encontradas ubicuamente entre varios esquemas de biomineralización . Recientemente , tuftelin ha demostrado que posee un dominio enriquecido en residuos acídicos y un dominio de auto organización , cada uno localizado en extremos opuestos de la proteína back - bone , sugiriendo que limitaciones especiales sobre la molécula del tuftelin pueden contribuir a su capacidad para interactuar con los cristales del esmalte.

La reciente clonación de ameloblastina introdujo una tercera clase de proteínas ameloblasto - especificas . La naturaleza de estas proteínas es actualmente tema de intenso interés y estudio . Mientras que la amelogenina y el tuftelin parecen estar restringidas en su expresión a ameloblastos comprometidos en el esmalte en formación , la ameloblastina se expresa por ameloblastos durante la amelogenesis, así como por células de la funda de la raíz epitelial de Hertwig durante la cementogenesis . El patrón espacial de expresión sugiere que la proteína ameloblastina participa en la génesis de ambos tipos de tejidos . El patrón de inmunodetección para la ameloblastina indica que este es encontrado en la interface entre la porción de Tomes del ameloblasto ( la extensión citoplasmática ameloblasto involucrada con la secreción de la proteína del esmalte) y la matriz orgánica de esmalte recientemente segregada , pero no parece extenderse entre la recientemente segregada y aún no mineralizada matriz orgánica del esmalte . Se ha sugerido una función de anclaje entre los ameloblastos y la matriz de esmalte para ameloblastina basados sobre este patrón de acumulación de proteínas.

Los resultados obtenidos en el presente estudio sugieren que es probable que el papel de la ameloblastina sea distinto a al de las enamelinas y amelogeninas . El papel de anclaje mas que estructural es consistente con la expresión continuada de ameloblastinas por células de la raíz de Hertwig durante el proceso de cementogenesis .

En tanto una función especifica para la ameloblastina en la cementogenesis está por demostrarse , Mac Dougall y sus colegas demostraron que la ameloblastina es un gel candidato para la forma autosomal de la enfermedad amelogenesis imperfecta hereditaria en por lo menos una familia afectada al colocar el locus de ameloblastina en área genética crítica para los defectos del esmalte . Estos investigadores están continuamente evaluando el estatus del cementum en esas familias .

El que la matriz orgánica del esmalte se orgánica en el espacio extracelular implica que las proteínas por si mismas contengan toda la información requerida para la organización . Al igual que otras matrices extracelulares ,es probable que la organización dependa de las proteínas y la distribución tridimensional de las proteínas dentro de la organización total de la matriz . Descifrando el "código" que dirige la organización de la matriz orgánica puede permitirse la construcción de materiales diseñados que imitarán de la matriz natural, proporcionando entonces nuevas luces sobre la creación de materiales restaurativos o matrices regenerativas . Un aspecto muy notable de la matriz del esmalte es el de que las proteínas comprendiendo los dominios de auto organización de ambos, amelogenina y tuftelin , no parecen tener ninguna afinidad unas con otras . La aparente falta de interacciones amelogenina - a - tuftelin (en el ensayo híbrido - dos levaduras ) sugiere que o bien un "puente" de proteínas que está aun por identificarse vincule amelogenina con tuftelin o bien que estas dos proteínas ejercen su influencia sobre los cristales en formación sin los beneficios de la interferencia de una con otra . En este sistema de "dos fases" para bio - actividad amelogenina y tuftelin parece no estar influenciado por ameloblastina . El hallazgo tanto en interacciones como de no interacciones proteína - a - proteína entre las proteínas del esmalte sugiere que ciertas restricciones actúan en la matriz orgánica del esmalte durante su auto - organización .

La amelogenina y la enamelina han sido identificadas dentro de la misma vesícula secretora por medio de inmunodetección de alta resolución , sugiriendo una intima relación para estas dos proteínas dentro de la matriz orgánica del esmalte . La ausencia de una aparente interacción entre las proteínas amelogenina y enamelina puede permitir que ellas sean co - segregadas en una vesícula sin posibilidad de una organización o ensamble prematuro de una con la otra . La formación de cristales de hidroxiapatita en el esmalte de los mamíferos se ha atribuido a interacciones específicas amelogenina - amelogenina , interacciones amelogenina - cristales y/o a interacciones tuftelin - cristales . Se ha sugerido que las enamelinas a causa de sus propiedades físicas y químicas actúan como sitios de nucleación durante la biomineralización del esmalte .

La proteína amelogenina purificada puede dirigir la deposición mineral en los extremos de los gérmenes de los cristales de hidroxiapatita sugiriendo entonces el papel de la amelogenina en el crecimiento de los cristales . La matriz de proteína del esmalte es transitoria , siendo removida en forma progresiva en la medida en que avanza el contenido mineral . En última instancia esta matriz de proteína del esmalte proporciona la interface definitiva entre los componentes orgánicos e inorgánicos , dirigiendo la iniciación , propagación y terminación de los cristales .

Previamente se demostró que la amelogenina y el tuftelin se auto ensamblarán . El estudio presentado aquí se demuestra la falla de la ameloblastina para auto - ensamblarse . Adicionalmente nosotros no fuimos incapaces de mostrar interacciones proteína - proteína entre proteínas disímiles de la matriz dele esmalte , indicando que el sistema híbrido - dos levaduras es una herramienta útil para el estudio de interacciones proteína - matriz dele esmalte que permitan la organización de la matriz . Aplicaciones futuras podrían incluir expresiones de cDNA hechas en denticiones en formación de los ratones en un intento por clonar otros genes involucrados en la organización de la matriz esmalte . Esta estrategia podría resultar en el clonamiento de proteínas con la capacidad par interactuar directamente formando un "puente" con una de las proteínas conocidas de la matriz del esmalte . Luces adicionales podrían arrojarse sobre el enigma continuando de la biomineralización del esmalte de los vertebrados cuando nuevas proteínas sean identificadas por medio del ensayo dos levaduras híbrido y su papel fisiológico pueda ser más claramente identificado.

Bashir y sus colegas reportaron recientemente una variación en la secuencia DNA tuftelin genómico de bovino con la descrita por Deutsch . Estos investigadores reportaron una proteína tuftelin faltándole los 45 residuos aminoácidos en el terminal carboxil como reporta Deutsch . El tuftelin de Bashir tiene también una diferente secuencia aminoácida predicha después del residuo 297 . La variación en la secuencia puede representar un polimorfismo en las fuentes de DNA usadas pero sugiere la posibilidad de que puede haber más de una secuencia carboxil terminal - aminoácido para las tuftelinas de bovino . La falta de 45 residuos aminoácidos en el terminal carboxil podría tener efectos insignificantes sobre la auto - organización de tuftelin , puesto que estos residuos parecen no tener ningún papel en mediar la interacción tuftelin - tuftelin . No obstante , una diferente secuencia proteínica después del residuo 297 puede tener algún impacto en la capacidad de tuftelin para auto organizarse.

4.4 AMELOGENINA, SEÑALAN MUTACIÓN DEL PEPTIDO: CORRELACIÓN ENTRE LAS MUTACIONES EN EL GEN DEL AMELOGENIN (AMGX) Y MANIFESTACIONES DE LA AMELOGÉNESIS IMPERFECTA X-UNIDO

Genomics

Imperfecta de Amelogenesis (AI) es una colección de desórdenes genéticos que afectan la formación de esmalte del diente. Hay varias formas clínicas y modos de herencia de AI incluso el autosomal recesivo, autosomal dominante, y se X-unió formas. El gen del amelogenin, localizó en los p22.1 - 22.3 región del cromosoma de X, se ha mostrado para ser deformado en varias familias con AI X-unido. Un poco de heterogeneidad genética entre las formas X-unidas de AI puede existir subsecuentemente que la enfermedad se ha trazado a un nuevo sitio en el brazo largo del cromosoma de X en una familia con XAI. nosotros hemos investigado el gen del amelogenin ahora en una familia con la forma del hipoplastic de XAI. El esmalte del diente de varones afectado en esta familia es duro y glaseado, con una superficie lisa, pero así que adelgaza que los dientes no se encuentran a los puntos del contacto y el color de los dientes varía de amarillento-blanco poner amarillo. hembras del portador en la exhibición familiar las manifestaciones menos severas de la enfermedad con islas de normal alterno y el esmalte afectado. Este más exacto se ha atribuido al inactivation del azar del cromosoma de X célula diferenciando para volverse ameloblasts.

Genomic ADN se preparó de los individuos afectado y normales en la familia y de los mandos normales. Cebadores de PCR que flanquean cada uno de los siete exons del gen del amelogenin y una región 5´ del sitio de salida de transcriptional eran construted del sepa sucesión del nucleotide del gen del amelogenin. Todo el exons y 170 bp 5´ del sitio de salida de transcripción fueron amplificados por PCR de muestras de ADN derivadas de un varón afectado, usando 10 pares del cebador. Se amplificaron Amelogenin gen segmentos de 1 ug de genomic ADN que usa 0.035 unit/ul de amplitaq en 50 mm KCl, 10 mm TrisHCl, pH 8.3, 1.5 mm MgCl, 125 mg/ml la albúmina de suero bovina, 200 uM cada dATP, dGTP, dCTP, y dTTP, y 1 uM cada cebador en un volumen de 150 ul, recubrió con 1-2 gotas de aceite mineral. Las condiciones de PCR eran 94 C para 1 min, templando para 1 min a las temperaturas en mesa 1, y 72 C para 2 min durante 30 ciclos seguidos por extensión a 72 C para 7 min. Nested PCR was performed to amplity exons 4,5 and 6 using primer pairs that do not amplify the homologous gene on the Y chromosome. Los productos de PCR eran vectores del cloned y sujetaron al análisis de sucesión de sólido-fase.

Secuencia Amplificada

Primer

Secuencia (5´-3´)

Annealing Temperature

Tamaño del producto (bp)

Upstream region

AI 01

GCCGAATTCCATATGCACTAATCACAAC

 

 

 

AI 02

GAATGTATTCAGTGCAAGTTTCTG

60

219

Exon 1

AI 11

GATATAGAATTCAGCTTATAGTTGGAAG

 

 

 

AI 12

TTTTAAAAGGAATGCAGAGAAAG

55

162

Exon 2

AI 21

CCGGAATTCAGAAAGAGATTTGAAAAGTGG

 

 

 

AI 22

GTCCAAGTTTGTGAAATTGGACCGTG

55

166

Seragation Analysis

AI 23

GATTTGAAAAGTGGATGTTGAC

 

 

 

AI 24

TGCAAGGGGTGTTTTACTCA

55

120

Exon 3

AI 31

TATGAATTCTCCTCCCCTCCTCCCTGTA

 

 

 

AI 32

GAGCCCAGGGCATTGTTAACGCAAA

60

136

Exon 4 + 5 first

AM 5

ACAGCTGGTTGGAGTCACCTGAGCCATT

 

 

 

AM 6

TCGACTACCTTTGTAGCCTGTTCAG

55

935

Exon 4 + 5 nested

AI 41

ACACAGTGCCTGTCACACAGGAAGCA

 

 

 

AI 52

CGGCCTGCAGGGAATAAGGAACAAAATGTC

60

272

Exon 6 first

AM 7

ACAGCTGGTTGGAGTCACCTGAGCC

 

 

 

AM 8

TCGACTACCTTTTGTAGCCTGTTCAG

55

940

Exon 6 nested

AI 61

TCCGAATTCTCTGGTTGGAGTCACCTGAGCCAA

 

 

 

AI 62

GCACCATTTTCACAGGATTTGCATTG

60

539

Exon 7

AI 71

GGAACATTTGTAAATTATTTTAACTG

 

 

 

AI 72

AATCTGCAGTTCCTACCTGATTCAACAATCA

55

260

Cloned Secuences

JS 1

GAGCGAATAACAATTTCACACAGG

 

 

 

JS 2

GCCAGGGTTTTCCCAGTCACGA

55

 

Una 9-bp tachadura se observó en exon 2 del gen del amelogenin en una muestra de ADN de un varón afectado. Esta tachadura no estaba presente en ADN prueba de los mandos normales. El siguiendo siendo seis exons así como los upstream de la región del gen del amelogenin eran idénticos a la sucesión normal.

El análisis de la segregación de la mutación se realizó en la familia para determinar que la ocurrencia de la tachadura pone en correlación con la enfermedad. Diez nanograms de genomic como los que ADN fue amplificado describieron sobre usar 0.2 uM de los cebadores AI 23 y AI 24 en un volumen de 10 ul, recubierto con una gota de aceite mineral. El cebador AI 23 era kinased con (y-P) ATP (Dupon) usando T4 kinase del polynucleotide. Dos microliters de cada reacción de amplificación estaba separado en un desnaturalizar 6% la gel del poluacrylamide. El diagnóstico de los fragmentos de la tachadura se demostró en muestras de ADN de los dos de los varones afectado. Las hembras de portador de fice eran heterozzygoys para la mutación con uno anormal y un producto de amplificación normal, mientras los dos varones sencillos y las dos hembras del noncarrier tenían fragmentos del normal-tamaño. La tachadura de 9 bp en exon 2 del gen del amelogenin pone en correlación así con el hypoplasia de esmalte en esta familia. La mutación ha quitado el codons para el isoleucine de los aminoácidos, leucine, phenylanine, y alanine: En cambio, un nuevo codon del threonine se crea.

Se espera que esta tachadura tenga consecuencias del serius al nivel de la proteína. Exon 2 al gen del amelogenin pone en código un 16 amino-ácido el peptide señalado. Los peptides señalados incluyen tres dominios distintos típicamente: y el amino-término cobró región de 1-5 residuos positivamente (n-región), una parte central, hidrófoba de 7-15 residuos (h-región), y un dominio carboxy-terminal más polar de 3-7 residuos (c-región). La mutación presente se predice para quitar tres hidrófobo y un residuo neutro en la h-región, y en cambio un residuo polar se introduce. Se han mostrado las tachaduras de aminoácidos en la h-región o substitución de residuos hidrófobos con cobrado a los resultados en peptides señalado exportación-defectivo. la región hidrófoba restante del amelogenin del mutante que el peptide señalado es que sólo residuos del fice anhelan, y contiene un residuo polar. La mutación es por consiguiente probable dañar el fuction del amelogenin el peptide señalado, produciendo translocation de la proteína defectivo durante la traducción. Los miembros afectado del esmalte de diente de exhibición familiar investigado que es corretly mineralizaron, pero de thicknees reducido. Este phenotype de una proteína requirieron para la formación de esmalte.

Hay sólo tres casos informados de mutaciones en peptides señalado humano que produce condiciones patológicas familiares. Un desuna el diathesis sangrante es el resultado de la substitución de un arginine para un glycine en el peptide señalado de factor de la coagulación X. El factor del mutante que X fue mostrado para ser correctamente translocated en el reticulum del endoplasmic, pero los peptide señalados deformados no pueden ser quitados por peptidase señalado. Otra mutación, destruyendo el sitio del cleabage para el peptidase señalado, ha sido informada por Ito y co-obreros. Ellos han identificado una mutación en el peptide señalado de preprovasopressin en el plasma en una familia con insipidus de la diabetes central. El tercio informó mutación del peptide señalada que causa enfermedad se parece la mutación en el estudio presente, como él el islocated en el centro hidrófobo del peptide de signo de preproparathyroid. La mutación es un T a transición de C que reemplaza el ánimo neutro el cysteine ácido con el arginine del aminoácido cobrado. Esta mutación daña el translocation y/o procesando de la hormona del preproparathyroid naciente en una familia afectados por hypopaathyroidism.

Nosotros hemos informado un XAI previamente el charaterized familiar por hypomineralization del esmalte. Los miembros afectado de esa familia tienen esmalte de espesor normal pero pobremente mineralizaron y por consiguiente más suave que normal. La mutación en esta familia es una 5-kb tachadura, quitando 5 de los 7 exons del gen del amelogenin. El codificando permaneciendo la sucesión se limita a 18 codons; 16 de éstos ponen en código el peptide señalado. Esta mutación destruye así completamente el fucntion de la proteína del amelogenin. Hypomineralization del esmalte en individuos afectado en este familu está de acuerdo con esta observación tiene informe otra familia con XAI. Los miembros afectado en esta familia exhiben hypoplasia y hypomineralization, pero los síntomas varían entre los miembros familiares afectado. La causa de la enfermedad en esta familia es una tachadura de un cytosine en exon 5 de la mutación. los autores estiman que un producto de la proteína de 74 aminoácidos se pone en código, faltando más de 200 aminoacidos de la proteína del amelogenina intacta. Una mutación idéntico a esto también ha sido informado por otro grupo.

Los resultados presentes, junto con los informes del previoys de mutaciones en el gen del amelogenin, implican la proteína del amelogenin en el proceso del mineralizarion normal así como en la formación de esmalte de espesor normal, desde los casos de XAI clasificados como hypolastic o hypomineralized es asociado con mutaciones en el mismo gen. Más allá los estudios moleculares de pacientes con formas diferentes de imperfeta del amelogenesis mejorarán el sistema de la clasificación clínico presente. Es más, las investigaciones de pacientes con phenotypes clínico diferente proporcionan valiosas visiones en los mecanismos la formación subyacente de tejido duro dental. Aumentado entendiendo de la biología de esmalte del diente puede permitir el desarrollo de técnicas por la regeneración de tejido duro dental dañado.

  1. CONCLUSIONES

En este trabajo podemos concluir que:

  • En el desarrollo del esmalte, los odontoblastos se retiran centralmente, dejando por detrás dentina formada. Los ameloblastos también se retiran, pero en dirección periférica, dejando esmalte recién formado sobre dentina previamente formada.
  • La formación del esmalte es un proceso complejo que comprende tres estadios. El primero es informativo e implica la secreción de una matriz orgánica, la matriz sufre el segundo estadio: la maduración, el tercer estadio en la formación del esmalte.
  • La amelogénesis es el proceso del esmalte que comprende: la elaboración de una matriz orgánica extracelular y la mineralización casi inmediata de la misma.
  • El ciclo vital del ameloblasto se constituye de la siguiente manera: etapa morfogénica (preameloblasto), etapa de organización o diferenciación (ameloblasto joven), etapa formativa o de secreción (ameloblasto activo, secretor o maduro), etapa de maduración, etapa de protección, etapa desmolítica.
  • La Amelogénesis Imperfecta tiene tres tipos, los cuales son: tipo hipoplásico, tipo de hipomineralización y alteración de corona.

  

6. BIBLIOGRAFIA

  1. DEL MARCO TEORICO
  • Motor de Busqueda "Altavista"

http://www.altavista.com

Internet

  • Histopatologia Bucal

 

 

Autor:

Año: 1991

  • Histologia de Tenlate

Comentarios


Trabajos relacionados

  • Métodos de esterilización

    Comprende todos los procedimientos físicos, mecánicos y preferentemente químicos, que se emplean para destruir gérmenes ...

  • Calculo de plantilla de medicina interna

    Datos, criterios y variables. Cálculos y resultados. Resumen, conclusiones y recomendaciones. La dotación en recursos ...

  • Colas animales

    Colágeno. Gelatina. Propiedades del colágeno. Uso cosmético del colágeno. Uso médico del colágeno. Aspectos básicos sobr...

Ver mas trabajos de Salud

 

Nota al lector: es posible que esta página no contenga todos los componentes del trabajo original (pies de página, avanzadas formulas matemáticas, esquemas o tablas complejas, etc.). Recuerde que para ver el trabajo en su versión original completa, puede descargarlo desde el menú superior.


Todos los documentos disponibles en este sitio expresan los puntos de vista de sus respectivos autores y no de Monografias.com. El objetivo de Monografias.com es poner el conocimiento a disposición de toda su comunidad. Queda bajo la responsabilidad de cada lector el eventual uso que se le de a esta información. Asimismo, es obligatoria la cita del autor del contenido y de Monografias.com como fuentes de información.

Iniciar sesión

Ingrese el e-mail y contraseña con el que está registrado en Monografias.com

   
 

Regístrese gratis

¿Olvidó su contraseña?

Ayuda