Agregar a favoritos      Ayuda      Português      Ingles     
 Página anterior Volver al principio del trabajoPágina siguiente 

La identificación de criminales a través del ADN (página 5)




Partes: 1, 2, 3, 4, 5, 6, 7, 8, 9


II.7.5- ANÁLISIS DE LA FRECUENCIA DE BASES

El análisis de frecuencia de las bases se realiza por medios bioinformáticos asociados a las máquinas robots secuenciadoras, las que dan os análisis y resultados en minutos.

Si bien desde el punto de vista técnico es relativamente fácil hoy en día obtener un resultado determinado, es necesario recalcar que la interpretación de los resultados debe ser cuidadosa y referenciada a un grupo población específico, respecto al cual pertenezca el individuo a identificar desde el punto de vista forense.

II.7.6 PROBABILIDADES DE IDENTIFICACIÓN.

Las probabilidades de identificación son mejores que 99.98 por ciento, en casos con suficiente material de inicio para su análisis. En caso contrario, es necesario amplificar la cantidad de ADN inicial, mediante un proceso denominado PCR (Reacción en cadena de la polimerasa, en la cual, un pequeño y escaso fragmento de ADN e amplificado o verdaderamente "fotocopiado o multicopiado "por métodos moleculares, lo que asegura la disponibilidad de una cantidad suficiente de ADN para llevar a cabo el análisis de modo satisfactorio. Sin embargo, esta técnica es muy sensible a la contaminación por ADN extraño, por lo que se deben extremar las medidas de limpieza profunda en el laboratorio o instalación donde se realiza.

II.7.7 RESULTADOS ESPERADOS.

Los resultados esperados para la identificación positiva de un individuo determinado, es que para el conjunto de marcadores genéticos escogidos, exista una identificación o concordancia que para fines estadísticos, debe ser de igual o mayor a 8 marcadores identificados positivamente. No obstante, es posible que el factor azar esté presente en este análisis, o que la variable llamada independencia de esperanza, es decir, la posibilidad que por razones de genética de poblaciones, dichos marcadores existen en esa expresión en grandes proporciones en una población de seres humanos específicos, siendo más de un individuo quienes compartan dichos marcadores específicos, con las consecuencias médico - legales correspondientes.

EL PRINCIPIO CENTRAL DE LA BIOLOGÍA MOLECULAR

El diagrama muestra el flujo de información desde el ADN hasta su codificación en una proteína, considerando las estructuras moleculares involucradas: ADN, ARN, ribosomas, ARN de transferencia, ARN mensajero, Nucleótidos y aminoácidos.

II.8 CARACTERÍSTICAS DE LOS EXÁMENES DE ADN

Los exámenes de ADN nuclear presentan algunas características que los hacen de mayor utilidad que los exámenes de otras pruebas ya conocidas y empleadas en medicina forense. Ellas derivan de las características de la muestra o de la naturaleza misma de los exámenes.

  1. Transmisibilidad hereditaria.

El ADN, en cuanto portador de información genética, es transmisible de padres a hijos, de modo que en toda persona la mitad del ADN nuclear procede del padre y la otra de la madre y todo el ADN mitocondrial exclusivamente de la madre.

2- Alto nivel de precisión.

Gracias al elevado polimorfismo de ciertos sectores de ADN, es posible lograr perfiles en los que la probabilidad de repetición se reduzca a cifras no representativas. Con excepción de los gemelos monocigóticos, todo ser humano tiene una estructura diferente de ADN.

  1. El ADN se encuentra presente en todas las células nucleadas y, por ende, en todos los tejidos, lo que permite su aislamiento desde prácticamente cualquier resto biológico.

  2. Universalidad de la muestra.

    A diferencia de lo que ocurre con las huellas dactilares, que necesitan un tipo, de soporte relativamente especial para estamparse y mantenerse, las muestras biológicas pueden ser recuperadas de una gran diversidad de medios.

  3. Universalidad del soporte.

    El ADN tiene una gran estabilidad en el medio ambiente y sin que se requieran condiciones excepcionales, siendo posible su aislamiento e identificación en células con meses, años y aun siglos de antiguedad.

  4. Gran estabilidad de la evidencia.
  5. Multiplicación de la evidencia.

Por último, gracias a la técnica replicante del ADN a través de la PCR, incluso cuando la evidencia obtenida sea pequeña, es posible poder realizar cuantos exámenes fueren necesarios.

Conocer la posibilidad y exactitud de los exámenes de ADN constituye un requisito fundamental, pues precisamente sólo ello permitirá sostener decisiones relevantes desde la perspectiva jurídica. No podemos olvidar que, en definitiva, lo que suele estar en juego es la libertad y el honor de una persona, y hasta hace poco en Chile y todavía en otros países, la propia vida.

La certeza de los exámenes se sustenta sobre la base "que todos los tejidos y fluidos corporales del mismo individuo poseen el mismo ADN y en consecuencia muestra el mismo perfil genético" y que nadie más posee esa identidad genética. Esta afirmación tan tajante se enfrenta al menos con tres problemas teóricos, derivados de la posibilidad que dos o más individuos compartan la misma huella genética o que uno sólo mantenga en su cuerpo dos o más tipos de ADN.

II.9 INTERROGANTES TÉCNICAS QUE SE PLANTEAN EN LAS BASES DE DATOS GENÉTICOS.

Las principales posibilidades de que se dé alguna de estas manifestaciones se pueden centrar en tomo a tres interrogantes:

  1. La interrogante estadística.

En sus orígenes estos exámenes presentaban un nivel significativo de imprecisión, lo que los hacía altamente cuestionables ante los tribunales. Así, en el conocido proceso contra O. J. Simpson, dos genetistas presentaron ante el jurado posiciones tan diferentes, que éste no logró convencerse de la responsabilidad del ex jugador, "más allá de toda duda razonable". Dado que la comparación se hace entre segmentos previamente determinados, mientras mayor sea el número de segmentos analizados, menores serán las posibilidades que dos personas diferentes presenten el mismo perfil genético. La precisión de los exámenes en este sentido ha experimentado un extraordinario crecimiento. En 1995, por ejemplo, cuando la PICH efectúa los primeros análisis de ADN vinculados a la investigación de un delito, sólo se logra precisar "con un 96,3% de certeza, que el genotipo de la víctima concordaba con la evidencia biológica encontrada en la vestimenta del sospechoso". En la actualidad, los exámenes se hacen considerando un mínimo de 9 marcadores (utilizándose hasta 16 si es necesario), lo que en términos matemáticos reduce las posibilidades de error prácticamente a un 0,0/o. Por ello, hoy día algunos autores afirman que "el estudio del ADN nos aporta una serie de características que estadísticamente permiten identificar al individuo con una probabilidad práctica del 100%".

EJEMPLOS DE ESTUDIOS DE POBLACIÓN DE ALELOS ESPECIFICOS DE CADA MARCADOR GENETICO EN ESTADOS UNIDOS

Allele Frequencies

for US Populations

Polymarker (LDLR, GYPA, HBGG, D7S8, Gc, DQAlpha) and STR (CSF1PO, TPO, TH01)

Shown are the allele count (number of times observed), frequency, and ± one standard deviation of sampling variation.

CSF1PO Population Studies

STR System

Population

Number of Samples

Reference

CSF1PO

Andalusian (Southern Spain)

150

285

CSF1PO

Chinese (Taipei, Taiwan)

116

153

CSF1PO

German Caucasian

312 alleles

028

CSF1PO

Hungarian Caucasian

223

368

CSF1PO

Italian (Campania, South Italy)

162

47

CSF1PO

Japanese (Tokyo)

150

35

CSF1PO

North American SW Hispanic

200

331

CSF1PO

North American Black

200

331

CSF1PO

North American Caucasian

200

331

CSF1PO

Polish (SE Poland)

155

442

CSF1PO

Portuguese Caucasian

153

417

CSF1PO

Spanish

187

389

CSF1PO

Spanish (Central and Eastern)

187

31

CSF1PO

Spanish Caucasian

158

436

CSF1PO

Swiss Caucasian

100

136

CSF1PO

Swiss Caucasian

100

329

CSF1PO

US Hispanic

216

432

CSF1PO

US Black

214

452

CSF1PO

US Caucasian

209

432

CSF1PO

US Black

203

450

CSF1PO

US African-American

202

432

CSF1PO

US Caucasian

201

450

CSF1PO

US Mexican-American

187

003

CSF1PO

US Hispanic

186

450

CSF1PO

US Black

184

003

CSF1PO

US Caucasian

172

003

CSF1PO

US Caucasian

148

451

CSF1PO

US African-American

145

451

CSF1PO

US Southwest Hispanic

96

451

CSF1PO

US Southeast Hispanic

94

451

CSF1PO

US Caucasian

86

452

CSF1PO

US Asian

72

003

CSF1PO

US Hispanic

60

452

FGA Population Studies

STR System

Population

Number of Samples

Reference

FGA (FIBRA)

French Caucasians

232

229

FGA

Japanese (Oita area, Southern Japan)

300

351

FGA

Portuguese Caucasian

153

417

FGA

US African-American

158

363

FGA

US West Coast Hispanic

113

363

FGA

US Caucasian

105

363

08/09/99

TPOX Population Studies

STR System

Population

Number of Samples

Reference

TPOX

Andalusian (Southern Spain)

150

285

TPOX

Chinese (Taipei, Taiwan)

116

153

TPOX

Finnish

354

075

TPOX

Galician (NW Spain)

260

396

TPOX

Galician (NW Spain)

125

185

TPOX

German Caucasian

150 alleles

028

TPOX

Hungarian Caucasian

223

368

TPOX

Japanese (Gifu Prefecture)

486

347

TPOX

Japanese (Gifu Prefecture)

314

304

TPOX

Japanese (Tokyo)

150

305

TPOX

North American Caucasian

200

331

TPOX

North American SW Hispanic

200

331

TPOX

North American Black

200

331

TPOX

Northern Portugal

273

284

TPOX

Polish (SE Poland)

155

442

TPOX

Portuguese (North Portugal)

164

388

TPOX

Portuguese Caucasian

153

417

TPOX

S. Tome e Principe (Gulf of Guinea)

147

310

TPOX

Spanish (Central and Eastern)

218

301

TPOX

Spanish

218

389

TPOX

Spanish Caucasian

158

436

TPOX

Swiss Caucasian

100

136

TPOX

Swiss Caucasian

100

329

TPOX

US Hispanic

216

432

TPOX

US Caucasian

209

432

TPOX

US African-American

204

432

TPOX

US Caucasian

148

451

TPOX

US African-American

145

451

TPOX

US Black

99

452

TPOX

US Southwest Hispanic

96

451

TPOX

US Southeast Hispanic

94

451

TPOX

US Caucasian

54

452

TPOX

US Hispanic

49

452

TPOX

US Caucasian

54

452

TPOX

US Hispanic

49

452

II.10 BASES BIOMOLECULARES DEL ESTUDIO DEL ADN EN MEDICINA FORENSE.

El ADN es un polinucleótido constituido por dos cadenas antiparalelas de unidades de desoxirribonucleótidos unidos covalentemente, dispuestos de una forma complementaria y adoptando una estructura enrollada de doble hélice dextrógira. Las bases que forman los nucleótidos son la adenina (A), guanina (G), citosina (C) y timina (T).

Su estructura fue descubierta por James WATSON y Francis CRICK en 1953, lo cual permitió afrontar su estudio de forma directa, evitando los dificultosos y complejos caminos indirectos que se habían utilizado hasta entonces.

Basándonos en la función del ADN podemos dividirlo en dos grandes grupos:

1.- ADN CODIFICANTE O ESENCIAL.

Es el encargado de almacenar la información genética en los genes, que son los diferentes sectores de ADN con un orden concreto en la disposición de los nucleótidos que determina la secuencia de aminoácidos de las proteínas que codifican y el grado de expresión del gen en cada tejido y en cada tiempo. Esta función del ADN se corresponde con la idea generalizada que se tiene sobre el mismo.

2.- ADN NO CODIFICANTE.

No obstante, existe otra parte del ADN cuya función específica es desconocida en la actualidad, aunque se sabe que no guarda información genética y que juega un importante papel en la estructura y en la función de los cromosomas y, sobre todo, actuando como puntos calientes de recombinación.

Este ADN puede ser de dos tipos: ADN espaciador, el cual está formado por una secuencia sencilla de bases que se dispone entre regiones codificantes del genoma; y ADN repetitivo, que lo forma una secuencia que, al contrario que el espaciador, se dispone por todo el genoma debido a la existencia de múltiples copias. A su vez este ADN repetitivo se divide según las características de la secuencia en "Secuencias repetidas en tándem", en las que existe una secuencia común relativamente corta que se repite en tándem de manera continua (una tras otra) en un fragmento de ADN y "Secuencias repetidas intercaladas", tratándose de una secuencia larga de bases que aparece repetida, pero no a continuación del primer grupo de secuencia repetitivo, sino en un lugar diferente y distante del genoma:

---- ATCGG ATCGG ATCGG ATCGG ATCGG ----

------- ATCCCCGGGAATCGATAAACGGATC ----------------------- ATCCCCGGGAATCGATAAACGGATC ------

Las características generales del ADN no codificante lo hacen especialmente útil para su aplicación a la identificación en Medicina Forense. Como se puede deducir de su trascendente función, el ADN esencial está formado por secuencias altamente conservadas con muy pocas variaciones interindividuales e intergeneracionales, ya que de lo contrario se podrían ver afectadas funciones básicas para la vida de las personas. Los mínimos cambios que tienen lugar, cuando son viables, aumentan el polimorfismo de proteínas y enzimas, aunque también pueden tener efectos negativos.

Por el contrario, el ADN no codificante presenta una gran variabilidad de unos individuos a otros, ya que estas secuencia no son conservadoras al no afectar sus cambios a la fisiología del individuo. Las variaciones debidas a cambios de bases sencillos, procesos de inserción-deleción o de intercambio de ADN (recombinación) durante la formación de las células germinales (meiosis), hacen que se modifiquen el número de repeticiones o el orden de las bases de un determinado fragmento repetitivo, pudiendo producirse en un locus sencillo o e múltiples loci, siendo este el origen de la variación que hace que no haya dos personas, a excepción de los gemelos univitelinos, que tengan la misma secuencia del ADN.

La repercusión práctica de lo anterior es la existencia de diferentes alelos, es decir la posibilidad de que encontremos entre la población varias formas de presentarse un determinado carácter o fragmento de ADN no codificante.

Los métodos más extendidos y de común aplicación en Medicina Forense para estudiar el ADN son:

1.- HIBRIDACIÓN CON SONDAS.

Básicamente consiste en la identificación de una región determinada mediante el uso de una sonda, que es un fragmento monocatenario de ADN complementario a una secuencia de bases conocida. Esta sonda, marcada con un producto radiactivo o quimioluminescente, se pone en la solución con el ADN de la muestra y se visualiza después de una serie de procesos para separar los diferentes alelos que puedan existir con base en la longitud de los mismos.

2.- REACCIÓN EN CADENA DE LA POLIMERASA (PCR).

Esta técnica supuso una verdadera revolución y es la más extendida en la actualidad, por sí sola o como paso intermedio de la secuenciación. Inventada por Kary MULLIS en 1987, le supuso el premio Nobel de Química el pasado año.

Gracias a esta técnica se puede amplificar una determinada región del ADN que está delimitada por una secuencia específica y complementaria a unas pequeñas sondas denominadas primers que actúan como iniciadores de la reacción de polimerización que lleva a cabo una enzima, habitualmente la Taq polimerasa. Esta enzima va uniendo desoxinucleótidos, que nosotros incluimos en la reacción, de forma complementaria a cada una de los fragmentos de las cadenas que se delimitan por los primers que son tomadas como moldes. La repetición cíclica de este proceso permite la obtención de múltiples copias de dicha región en una cantidad suficiente para ser estudiada. Posteriormente, el ADN amplificado se puede visualizar mediante la separación de los alelos de diferente tamaño y tinción o estudiando las variaciones de su secuencia.

De este modo es posible que cuando dispongamos de muy escasa cantidad de ADN en un indicio o esté parcialmente degradado, sea posible amplificarlo y obtener una cantidad suficiente para su análisis.

3.- SECUENCIACIÓN.

Las técnicas de este grupo van destinadas a revelar el orden de la secuencia de bases de una determinada región, normalmente delimitada previamente por PCR. Puede hacerse de forma manual o automática.

En Medicina Forense se aplica, fundamentalmente, para el análisis del ADN mitocondrial por sus especiales características.

En todos los casos es necesario que exista polimorfismo, es decir, que el fragmento o secuencia que vamos a estudiar sea polimórfico, lo que básicamente podemos entender como variabilidad, o sea que se presente de formas diferentes, ya que de lo contrario no podremos identificar a los individuos.

Todo lo anterior nos lleva a destacar dos grandes aspectos de la investigación del ADN en nuestra especialidad:

1.- Se trata de ADN no codificante, es decir, que la información obtenida tras su análisis no nos puede aportar nada sobre ninguna de las características fenotípicas del individuo. No obstante, conforme van avanzando las investigaciones sobre el Proyecto Genoma Humano se van descubriendo que parte del ADN no codificante está relacionado con alguna característica fenotípica, bien de tipo fisiológico o bien patológico (enfermedades). En cualquier caso en la mayoría de los casos la información es poco significativa desde el punto de vista práctico, tratándose más de un interés científico.

2.- Al igual que en tantos otros métodos de identificación médico-forense, es necesario llevar a cabo una comparación entre el perfil genético obtenido del indicio o muestra y el genotipo de un individuo o evidencia orgánica.

II.11 ASPECTOS TÉCNICOS ESPECÍFICOS

II.11.1 ZONAS NO CODIFICANTES

El ácido desoxirribonucleico (ADN) es el material genético que se encuentra en casi todas las células del cuerpo humano. Puede almacenarse en diferentes zonas de la célula. El ADN nuclear se encuentra en el núcleo, y se hereda mitad de la madre y mitad del padre, con excepción del ADN presente en el cromosoma Y masculino, que sólo puede heredarse por línea paterna. El ADN mitocondrial está presente en los orgánulos de la célula conocidos como mitocondrias y sólo se hereda por línea materna. Aunque estos dos tipos de ADN se diferencian por su origen y función, estructuralmente son similares. Ambos pueden aportar valiosas pruebas en las investigaciones de los delitos, pese a lo cual las bases de datos nacionales sobre ADN y la futura base de datos sobre ADN de Interpol incluyen únicamente información sobre ADN nuclear. El proceso conocido como análisis de ADN comienza con el examen del material genético recuperado de muestras diminutas tomadas de tejidos humanos o fluidos corporales, como la sangre o el semen; así se obtiene una "huella" o un "perfil", sinónimos en relación con este tema. El perfil resultante es una serie de códigos alfanuméricos que se pueden comparar fácilmente con otros de referencia o ya conocidos, y posteriormente archivar en un ordenador. Si se estudian suficientes zonas del ADN, el perfil final puede ser relativamente único para cada individuo, o corresponder a la línea paterna o materna.

En la actualidad, el análisis de ADN es relativamente simple. El proceso se compone de las siguientes etapas: la recogida de muestras en el lugar del delito, así como de las víctimas y los sospechosos; la extracción, purificación y cuantificación del ADN de todas las muestras; la copia o amplificación de segmentos cortos de ADN; la visualización de los fragmentos; el análisis de los resultados y su transformación en códigos alfanuméricos; la comparación visual o mediante ordenador de los códigos obtenidos.

Todos los sistemas de ADN a que se hace referencia en un análisis forense se concentran en las zonas no codificantes del genoma. Esto significa que no incluyen información acerca de las características físicas o psicológicas, las enfermedades o la propensión a las mismas.

II.11.2 LA TÉCNICA RFLP

En 1985 el Dr. Alec Jeffreys describió por primera vez la técnica de la "huella genética". La tecnología que utilizaba el análisis de los polimorfismos de longitud de los fragmentos de restricción ("Restriction Fragment Length Polymorphisms", RFLP) fue el método inicial empleado en los análisis forenses de ADN y fue adoptado en varios países. Como requiere una elevada cantidad de ADN no degradado, la tecnología RFLP ya no es el método preferido en la mayoría de los laboratorios de pruebas forenses del ADN. A continuación se incluye información sobre esta metodología debido a que algunos de los principios aplicados en este tipo de análisis también son aplicables a la tecnología más actual. La prueba RFLP se basaba en el análisis de segmentos de ADN humano llamados regiones hipervariables que se encuentran en el genoma humano. La variación es la del número de segmentos repetidos en tándem ("variable number of tandem repeats", VNTR) en distintas regiones o loci (el singular de "loci" es "locus") del ADN. Una repetición es una secuencia determinada de un número de pares de bases. Un "alelo" es una variante del número de repeticiones en un locus.

II.11.3 REACCIÓN EN CADENA DE LA POLIMERASA

Con una sonda radiactiva o quimioluminiscente multilocus, se pueden detectar, de forma simultánea, las repeticiones de fragmentos, tanto en un locus como en varios loci a la vez, lo que permite obtener un patrón de múltiples bandas, el llamado "patrón de código de barras", relativamente único para cada persona. No obstante, se plantean problemas cuando se analizan muestras forenses que consisten en una mezcla de fluidos corporales, ya que en este caso el perfil del ADN es demasiado complejo para que se pueda interpretar. La utilización de una sonda de locus único (SLP) para la detección de un locus únicamente en cada ocasión supuso un gran avance de la técnica de análisis de ADN, ya que con esta sonda se obtiene un perfil simple de una o dos bandas cada vez. La técnica consistente en la utilización de varias sondas de locus único, una después de otra, da como resultado una serie de patrones de barras, cuya combinación tiene un poder discriminatorio tan alto como el de la sonda multilocus. La detección radiactiva se sustituyó por la detección quimioluminiscente, lo que dio lugar a un método más rápido de análisis habitual de manchas biológicas forenses.

Un método llamado "Reacción en cadena de la polimerasa" ("Polymerase Chain Reaction", PCR) se utiliza para amplificar o copiar regiones del ADN, lo que permite obtener perfiles a partir de cantidades mínimas de material genético. El proceso de la PCR revolucionó hasta tal punto la esfera de la biología molecular que su inventor, el Dr. Kary Mullis, recibió el Premio Nobel por su descubrimiento. Mediante la utilización de este proceso se producen millones de copias de segmentos seleccionados de regiones variables de ADN, que se pueden utilizar para obtener perfiles.

La principal ventaja del método PCR sobre el RFLP es que hace posible el análisis con una cantidad pequeña de ADN. Asimismo, la técnica de la amplificación es rápida y extremadamente útil para analizar el ADN a partir de material humano degradado encontrado en muestras biológicas antiguas o parcialmente deterioradas. Por este motivo, las pruebas basadas en la PCR se han convertido en un método estándar utilizado en la práctica totalidad de los laboratorios de policía científica.

La técnica preferida actualmente para el análisis de ADN humano se basa en el examen mediante PCR de los loci de ADN microsatélite (STR) (es decir, secuencias repetidas de ADN en las que las unidades de repetición polimórficas se componen generalmente de dos a cuatro pares de bases). Se ha observado que las repeticiones de secuencias tetra y pentanucleótidas son las más estables para el análisis mediante PCR. Estas STR pueden amplificarse sin problemas incluso a partir de cantidades inferiores al nanogramo de ADN. La separación de los fragmentos amplificados se lleva a cabo mediante electroforesis sobre gel o capilar. La amplificación simultánea de loci STR mediante la técnica de PCR multiplex y la detección automática de los fragmentos de ADN hacen posible un sistema de análisis rápido y sensible que permite aprovechar al máximo las muestras y tiene un alto poder de discriminación.

II.11.4 ADN MITOCONDRIAL (ADN-mt)

Con una sonda radiactiva o quimioluminiscente multilocus se pueden detectar, de forma simultánea, las repeticiones de fragmentos, tanto en un locus como en varios loci a la vez, lo que permite obtener un patrón de múltiples bandas, el llamado "patrón de código de barras", relativamente único para cada persona. No obstante, se plantean problemas cuando se analizan muestras forenses que consisten en una mezcla de fluidos corporales, ya que en este caso el perfil del ADN es demasiado complejo para que se pueda interpretar. La utilización de una sonda de locus único (SLP) para la detección de un locus únicamente en cada ocasión supuso un gran avance de la técnica de análisis de ADN, ya que con esta sonda se obtiene un perfil simple de una o dos bandas cada vez. La técnica consistente en la utilización de varias sondas de locus único, una después de otra, da como resultado una serie de patrones de barras, cuya combinación tiene un poder discriminatorio tan alto como el de la sonda multilocus. La detección radiactiva se sustituyó por la detección quimioluminiscente, lo que dio lugar a un método más rápido de análisis habitual de manchas biológicas forenses.

En función del tipo de prueba, y en el marco de los análisis genéticos forenses, la utilización del ADN-mt como procedimiento alternativo para la amplificación y el análisis de ADN pueden presentar ventajas importantes. Debido al gran número de copias de ADN-mt (más de 1.000) presente en cada célula, este tipo de análisis tiene un alto grado de sensibilidad.

Así pues, el análisis de ADN-mt puede utilizarse en casos en los que sólo puede obtenerse una cantidad limitada de ADN nuclear de la muestra. Por ejemplo, en el tejido óseo, los dientes y el pelo se encuentran a menudo unas cantidades de ADN nuclear tan pequeñas que no se puede obtener un perfil de STR. El análisis del ADN-mt resulta especialmente útil en estas circunstancias. Algunos estudios revelan que la secuenciación de fragmentos amplificados de ADN-mt es un método válido y fiable de identificación forense. No conviene utilizar mezclas de fluidos para los análisis de ADN-mt, y no se pueden comparar los perfiles obtenidos de ADN nuclear con los obtenidos de ADN-mt.

Una característica que hay que tener en cuenta para el uso forense de los análisis del ADN-mt es que, además de los hermanos, todos los parientes por vía materna muestran la misma secuencia de ADN-mt, lo que significa que las personas de este grupo no pueden ser identificadas por separado. Por esta razón, los vínculos familiares pueden comprobarse muy fácilmente.

Un posible inconveniente de esta técnica es su complejidad, en particular a causa de una eventual heteroplasmia, y su extrema sensibilidad a la contaminación. Por otra parte, resulta cara y lenta, y sus resultados tienen menos poder discriminatorio que los del análisis del ADN nuclear.

III DISCUSIÓN

La discusión sobre la hipótesis planteada, y la ley o leyes referidas a ella y los alcances de ella, se discuten en la perspectiva técnica, que modula el aspecto médico legal y jurídico, así, podemos considerar, al menos tres áreas de discusión importantes, como son:

III.1 Respecto de las secuencias aparentemente no codificantes:

Los autores señalan que se debiera ocupar secuencias respecto de las cuales NO se tenga constancia que codifican información génica expresable.

Desde un punto de vista lógico, lo correcto es decir que se debieran utilizar secuencias génicas respecto de las cuales SI existe constancia que NO codifican secuencias que se expresan.

Al momento de realizar este trabajo, no se referencian dichas secuencias, y son la base para establecer y demostrar la hipótesis de trabajo de esta investigación.

III.2 Respecto de los Kits.

El desarrollo del análisis está en manos de privados ( quienes manufacturan estos kits ) nada se ha expresado respecto al control de calidad y/o posibles errores generados por la naturaleza de los materiales utilizados,

¿cual sería la responsabilidad civil o criminal de dichos proveedores ante un posible error en el desarrollo de un proceso de identificación ?

La ley no se pronuncia al respecto.

III.3 Análisis General Del Proyecto De Ley

Los antecedentes que consideró el estado de Chile para plantear este proyecto de ley se pueden reunir en un conjunto de necesidades respecto de la administración de la Justicia y el alcanzar el Bien Común consagrado en la Constitución. En esa perspectiva o marco conceptual se organiza la tarea de, potencialmente, vulnerar los derechos de unos , para facilitar el acceso a la verdad y a la justicia a otros. Ese conflicto está presente en cada situación penal, en la que le corresponde al Estado el dirimir los intereses de las partes en conflicto, es decir, aquellos casos en los que se ha ejecutado un determinado hecho ilícito, de aquellos que nuestra sociedad ha catalogado como de la mayor gravedad, ameritando la aplicación de una pena en base a conductas que importan el quebrantamiento de derechos individuales de las víctimas (delito).

En ellos pareciera optarse por afectar los derechos de algunos (quienes cometen delitos) en razón que se afectaron derechos de terceros (las víctimas).

Definitivamente el bien común obliga al Estado a promover el desarrollo individual de cada uno de los integrantes de la sociedad, en correlación —lo más perfecta posible— con los derechos de sus semejantes. Para ello, debe propender a la existencia del correcto amparo y protección de los derechos individuales, en tanto sirvan al desarrollo colectivo de toda la población.

Esta finalidad pública, lo eleva como la base esencial de su actuación, tal como lo refleja el artículo 50 de nuestra Constitución.

En dicho precepto, el Estado se autoimpone como límite inherente a sus facultades el respeto y promoción de los derechos individuales de cada uno de los integrantes de la comunidad.

Así, se ampara el derecho de las minorías en aquello que les es consustancial y por ende inalienable, como son los derechos esenciales del ser humano.

Sin embargo, esta función esencial —tal y como ya hemos señalado— detenta un límite meridianamente claro, radicado en el espacio de desarrollo legítimo de los derechos de los demás. Por ello, frente a situaciones límites, en que se plantea la necesidad de comparar y optar por los derechos individuales, debe primar aquel que mejor sirve al bienestar común.

De ahí que el Estado tenga la función de reprimir aquellas conductas que, en tanto vulneran ilegítimamente derechos de terceros, quebrantan esta base esencial de convivencia. Para ello se recurre a diversas herramientas, siendo la más extrema aquella que nos ofrece el sistema penal, definida en su esencia por constituir una vulneración en el ejercicio de derechos individuales. Toda pena conlleva la afectación en dichos derechos, pero de una forma legítima, necesaria y útil para el Estado.

Ello explica, por una parte, que, para reprimir los actos y conductas que en forma más grave atentan contra la población, deba aplicarse una pena y restringirse derechos individuales; y por la otra, explica que para determinar las responsabilidades individuales, se haga necesario interceptar comunicaciones, afectar la inviolabilidad del hogar o, incluso, la libertad ambulatoria de algunas personas.

En este marco, y dentro de las actuaciones que son necesarias y legítimas para la paz social, el Estado debe procurar el máximo de eficiencia.

Para ello debe dotar a los órganos investigadores del máximo poder para esclarecer los delitos, y demostrar la inocencia o culpabilidad de los involucrados en un ilícito. Este poder, debe ser supeditado a los principios de respeto a los derechos humanos,

La referida ley se basa en las características específicas que presenta el material genético respecto del particular nivel de confiabilidad que proporciona este antecedente.

Se espera que en una muestra de alta perfección, sea posible obtener un 99,9% de exactitud de la identificación practicada, arrojando asimismo un 100% de efectividad para acreditar la inexactitud del análisis comparativo.

Se plantea la experiencia de numerosos países en los que se mantienen este tipo de archivos, aquello certifica que la existencia de registros del ADN de las personas que fueren condenadas por la comisión de ilícitos penales permite una rápida identificación de los responsables, particularmente frente a casos de reincidencia delictual.

Ello posibilitaría que frente a otros procesos criminales se obtenga de manera rápida, efectiva y segura, la identificación de los presuntos responsables de haber incurrido en algún ilícito penal, como asimismo contribuye a la rápida acreditación de la inocencia de quienes, no obstante haber sido imputados de un delito, son inocentes del mismo.

Este tipo de análisis se agrega a otros que de acuerdo a la normativa vigente, ya se practican, en efecto, la legislación procesal penal contenida en el Código de Procedimiento Penal y en el Código Procesal Penal, permite, con los resguardos del caso, la práctica de exámenes corporales al imputado, inculpado o procesado, dentro de los cuales se incluyen las pruebas de carácter biológico, extracciones de sangre u otros análogos. A estos exámenes, el proyecto agrega el de ADN.

El desarrollo de estos análisis se halla habilitada técnica y materialmente, a través del Servicio Médico Legal, para evacuar las necesidades y requerimientos que son demandados desde los tribunales de justicia.

El carácter de exclusión de la utilidad de la prueba respecto de la causa específica, ha llevado a utilizar esta prueba pericial exclusivamente en el curso de procesos en que la detección de la muestra y su utilidad parece más evidente, como particularmente sucede en los ilícitos de naturaleza sexual. Pero su amplitud y aporte como mecanismo de identificación excede esos ámbitos.

III.4 CUESTIONES RELATIVAS A LA GENÉTICA DE POBLACIONES

Se ha discutido mucho sobre cómo explicar el valor de la prueba en el informe forense cuando el perfil del ADN acusatorio coincide con el del ADN del sospechoso. Para evaluar el valor probatorio, los expertos en policía científica tienen que calcular la frecuencia con la que se presenta el perfil de ADN obtenido y la probabilidad de que el perfil del ADN utilizado como prueba coincida con el de una persona inocente elegida al azar.

Se han establecido otros métodos para tratar estos problemas: el "National Research Council" se ocupa de ellos en su segundo informe (NRCII), publicado por la "National Academy Press" (1996), así como las directrices de la ENFSI.

Para producir los perfiles de ADN se analizan loci heredados. La frecuencia de un perfil de ADN en una población elegida al azar se calcula mediante reglas estadísticas bayesianas.

Respecto de la distribución poblacional de los marcadores genéticos, podemos establecer que aquellos no han sido estudiados en Chile, no hay mayores estudios que muestren o reflejen la distribución de ellos en nuestro país, en el grado necesario como para establecerlos como referencias poblacionales estadísticamente significativas. Más aún, es posible que aquellos marcadores muestren distintas distribuciones poblacionales, dependiendo de las características de ascendencia racial, o niveles de consanguineidad, o aislamiento geográfico, lo que genera un alto valor en la distribución de dichos marcadores.

Por ejemplo, el caso de una isla, como Chiloé o Isla de Pascua, o los extremos norte y sur de Chile, donde el rango de parentezgo es alto, las características poblacionales pueden entregar mayores frecuencias para la distribución de un marcador genético determinado, por lo tanto, la llamada "independencia de esperanza" que es un factor estadístico de referencia, debe ser considerado cuidadosamente en estos escenarios. En este estudio se entregan algunos datos estadísticos poblacionales para algunas minorías étnicas raciales en Estados Unidos. (Ver aspectos técnicos en el Marco teórico).

Es necesario poner de manifiesto la importancia de la población de referencia. El perito genético debe escoger la población del entorno del caso, que normalmente coincide con un grupo poblacional concreto.

La ley no se pronuncia a este respecto.

III.5 NORMALIZACIÓN MUNDIAL DE LA TECNOLOGÍA DEL ADN

La investigación criminal internacional exige que los aspectos cualitativos de la investigación del ADN sean idénticos en los diversos países con el fin de intercambiar resultados comparables. Las bases de datos nacionales tienen que fundarse en la utilización de loci del ADN normalizados y de un control de la calidad y un sistema de garantía de la calidad internacionalmente reconocida.

Diversos grupos de trabajo han logrado considerables progresos en la normalización. En 1989 el Grupo de Examen del ADN Europeo (EDNAP) inició una serie de experimentos para lograr unas normas comunes sobre la nomenclatura. La metodología normalizada ha sido promovida por el Grupo de Trabajo sobre el ADN de la Red Europea de Institutos de Ciencia Forense (ENFSI). Los grupos de trabajo de la ENFSI sobre garantía de la calidad y lugar del delito están participando también en la armonización de la técnica del ADN. Además del EDNAP y de la ENFSI en Europa, grupos como el Grupo de Trabajo Científico sobre los Métodos de Análisis del ADN (SWGDAM) en los Estados Unidos y la Asociación Nacional de las Autoridades Encargadas de las Pruebas (NATA) en Australia han abordado estos problemas.

III.6 DEMOSTRACIÓN DE LA HIPÓTESIS DE TRABAJO

La Hipótesis de Trabajo propuesta fue que si bien la información genética en las bases de datos de ADN forense es sensible desde el punto d vista legal, porque está amparada en el cuerpo de la ley respectiva, desde el punto de vista médico – legal o biológico no lo es, al no constituir dicha información, secuencias codificantes o expresión de gen alguno en la población de referencia de estudios forenses respectivos.

Para demostrar esta hipótesis, hemos considerado todo el conjunto de información recopilada y entregada en este trabajo, en particular la ley 19970 promulgada recientemente.

La promulgación de la ley 19970 ha generado el interés que despierta la información genética en tanto es una información íntima de las personas en particular.

Se debe diferenciar entre información codificante y no codificante

Se entiende por información codificante o exones, aquella que, contenida en el ADN, es expresada en una proteína luego de su transcripción a ARN y su traducción a proteína.

Se entiende por información no codificante o intrónica, a aquella que, contenida en el ADN, NO es expresada en una proteína o producto biológico.

Desde el punto de vista molecular, las secuencias genéticas de intrones, están presentes en grandes porciones del genoma humano.

Las secuencias intrónicas en particular, (las no codificantes), están presentes en todo el genoma, no se conoce su función específica, pero se infiere, por las funciones de la información genética en general, que podría ser una especie de reservorio molecular para facilitar la codificación de genes.

Dentro de las secuencias intrónicas, se hallan en particular un conjunto de secuencias polimórficas, es decir, que en una población específica de seres humanos, se pueden hallar un gran número de secuencias variables entre las halladas en cada ser humano, constituyendo una verdadera "huella dactilar molecular".

Es sobre este tipo de secuencias que se trabaja en el desarrollo de secuencias identificatorias para fines forenses.

A nivel internacional, organismos como el FBI, en conjunto con el NIH ( National Institute of Health ) han desarrollado un conjunto de 13 secuencias para fines forenses de identificación.

Estas secuencias se presentan en anexo, y constituyen el llamado CODIS (Combines DNA Information System).

De la observación general, podemos apreciar que su distribución está presente en casi todos los cromosomas humanos, no siendo una distribución agrupada, sino que al azar, en particular, se puede apreciar que no obedece patrón de distribución alguno, salvo el azar propio de los procesos evolutivos de adaptación biológica que llevan a cabo todos los seres vivos, incluido el hombre.

El estudio detallado de dichas secuencias, ha permitido apreciar que no presentan la codificación de ninguna secuencia de ARN o ácido Ribonucleico complementaria, y, por ende, no codifican para ningún aminoácido, por lo que no expresan o codifican proteína alguna, es decir, en definitiva son intrones.

Por lo anterior, tenemos entonces secuencias de ADN (ácido desoxirribonucleico) que presentan una gran variabilidad entre ellas, es decir entre las halladas en uno y otro ser humano, y cada secuencia encontrada en cada ser humano, no codifica para ningún producto biológico como proteínas y por ende no presenta función fisiológica conocida.

Por ello, estamos en presencia de secuencias que no aportan información alguna sobre el perfil fisiológico, biológico, o médico del individuo a quien se le analiza, constituyendo entonces una secuencia meramente identificatoria, un código de secuencia de moléculas expresada en un conjunto alfanumérico ordenado.

Considerando los antecedentes y características de estas secuencias presentadas aquí, es que se plantea el hecho que las secuencias identificatorias no debieran constituir información sensible, pues no presentan o representan o no se puede inferir de ellas, directa o indirectamente, información biomédica alguna, que nos permita correlacionar alguna característica personal o individual, con dichas secuencias.

Por ello, la información de secuencias contenida en la base de datos de ADN es sensible, solo desde el punto de vista legal, amparada en la ley que protege la vida privada de las personas, aun cuando dicha información no pueda ser correlacionada con información biomédica o personal alguna.

Más aún, la misma ley 19970, establece que: "No podrán ser parte de las secuencias identificatorias aquellas que no sean polimórficas o codificantes de algún gen y, por ende, expresables".

En el mismo cuerpo legal, se establece que si en algún momento, se descubriera que dichas secuencias marcadoras utilizadas son expresables o codificantes, dicha secuencia identificatoria deberá ser eliminada y reemplazada por otra, manteniendo así el carácter polimórfico y no codificante de las secuencias marcadoras.

Por todo lo anterior, la información contenida en las bases de datos de ADN para fines identificatorios y forenses, es información sensible solo desde el punto de vista legal o jurídico, pero en su substancia o de modo intrínseco, no lo es.

IV CONCLUSIONES

IV.1 EL ANÁLISIS DE ADN COMO HERRAMIENTA DE IDENTIFICACION

El desarrollo científico ha permitido la introducción de la tecnología del ADN en la investigación forense, posibilitando el estudio de indicios biológicos mínimos, hecho que unos pocos años atrás era imposible. El Médico Forense se encuentra en una posición privilegiada para recoger algunos vestigios que por su fragilidad pueden alterarse o perderse como consecuencia de una actuación retrasada, permitiendo su estudio y la resolución del caso, con las consecuencias beneficiosas que de ello se derivarían.

Por otra parte, al margen de la profesionalidad y del compromiso deontológico, se está produciendo una exigencia por parte de la sociedad, cada vez más conocedora de las posibilidades técnicas existentes a través de los medios de comunicación, reclamando una responsabilidad profesional del personal encargado del caso, al igual que en otros campos de la Medicina. Así en Estados Unidos se han presentado ya querellas criminales contra hospitales, médicos y cuerpos policiales no federales por mal praxis y negligencia, al no recoger indicios criminales que podrían haber conducido a la identificación del autor de los hechos denunciados (en la mayoría de las reclamaciones admitidas, por defectos en la toma o conservación de supuestos indicios de semen en casos de violación).

El estudio del ADN ha supuesto un enorme "paso de gigante" en la identificación médico-forense, tanto en la investigación criminal, como en la investigación biológica de la paternidad. Las especiales circunstancias en las que se desenvuelve la primera de ellas hace que el potencial tecnológico no sea suficiente para la consecución del objetivo si previamente no se ha realizado un buen trabajo por parte del equipo de investigación encabezado por el Médico Forense, que por su formación y especialización es el profesional idóneo para valorar los indicios biológicos.

En los casos en los que haya que recoger las evidencias, debe hacerse en condiciones de máxima limpieza o esterilidad todos los indicios de origen biológico presentes, almacenándolos independientemente y adecuadamente identificados en cuántos recipientes estériles sea necesario y manteniéndolos custodiados en un frigorífico hasta recibir las instrucciones oportunas por parte de las Autoridades Judiciales. Cuando se proceda al envío de las muestras, hay que asegurarse de que no se romperá la "cadena de frío".

IV.2 CARACTERÍSTICAS DE DATOS SENSIBLES DE LA INFORMACIÓN GENETICA CONTENIDA EN LOS REGISTROS DE ADN

La información genética se establece como sensible, desde el punto de vista de su codificación a algún producto de expresión. ya sea biológico o metabólico, en ese sentido, es altamente necesario y de la mayor importancia, para proteger los derechos consagrados de las personas respecto de su dignidad, intimidad y vida privada, que las secuencias sugeridas o adoptadas como marcadores genéticos como los contenidos en el CODIS u otras bases de datos, no presenten expresión génica, es decir, sean secuencias de ADN intrónicas. o intrones. Solo así se estarán respetando y salvaguardando los principios considerados en la elaboración de esta ley.

Para lograr lo anterior, es necesario mantener una vigilancia constante respecto de los hallazgos que se realicen respecto de dichas secuencias, todos ellos consignados en bancos de secuencias genéticas como el gene bank y otras, de acceso via internet y a disposición global por todos los gobiernos del mundo

IV.3 VULNERABILIDADES DEL SISTEMA DE IDENTIFICACIÓN GENETICA

3.1- MARCADORES GENETICOS

Se debiera mantener una biblioteca de secuencias específicas para ser utilizadas como marcadores genéticos, en especial en Chile, al presentar aspectos raciales, de consanguineidad y aislamiento territorial particulares, lo que se traduce en distribuciones poblacionales de genes específicos distintivas respecto a las frecuencias poblacionales halladas para esas secuencias génicas en otros países o grupos raciales o étnicos o territoriales. Ello redundaría en un protocolo de análisis con mejores perspectivas de niveles de calidad respecto de la pericia forense.

3.2- ASPECTOS POBLACIONALES

Chile presenta distribuciones poblacionales de sus habitantes específicas, que constituyen nuestra propia identidad cultural y étnica, en esa perspectiva, es necesario considerar aspectos como la consanguineidad de sus habitantes en las zonas extremas norte y sur de nuestro país, en las islas ( Isla de Pascua, Chiloé y Juan Fernández ), grupos étnicos específicos reconocidos por la ley, por todo lo anterior, es necesario adoptar medidas de trabajo estadístico que den cuenta de la distribución demarcadores genéticos a nivel local, y disponer así de estudios de referencia de distribución poblacional de marcadores genéticos como e posible hallarlos en otros países y es recomendado además por organismos policiales internacionales como INTERPOL o el FBI en Estados Unidos.

IV.4 EL CONTROL DE CALIDAD COMO HERRAMIENTA DE GESTION DEL PROCESO.

Organismos técnicos policiales internacionales como INTERPOL o el FBI establecen rigurosas medidas de control de calidad integral a todo el proceso de desarrollo de una pericia, desde la toma de muestras desde el lugar de los hechos, hasta la entrega de resultados y comunicación con otros organismos internacionales. Estas directrices se entregan de modo general en este trabajo y reflejan la necesidad de llevar a cabo las pericias de modo profesional y eficaz, al estar involucrados recursos ingentes en este tipo de pericias y para asegurar la buena práctica forense.

IV.4.1 PROTOCOLOS DE CONTROL DE CALIDAD PROPUESTOS PARA EL PROCESO

Se proponen los protocolos de control de calidad de procesos periciales en anexos, como lineamientos generales a adoptar por los organismos responsables de realizar las pesquisas para asegurar una buena práctica forense en nuestro país.

IV.5 CARACTERÍSTICAS RELEVANTES DE LA LEY 19970

1. Finalidad del registro

El Registro tiene por objeto exclusivo facilitar el esclarecimiento de los hechos que sean objeto de una investigación criminal, particularmente en lo relativo a la identificación de las personas que fueren responsables del mismo.

En ningún caso podrá solicitarse o consultarse la información contenida en él para otros fines o instancias que no sean los propios de un proceso criminal.

2. Necesariedad

Los análisis de ADN se limitan al ADN no codificante, el cual, además de caracterizarse por su gran variabilidad entre individuos, no revela otros datos que los meramente identificatorios.

La limitación de los análisis a estos marcadores no codificantes, elimina toda vulneración del derecho a la intimidad, dado que los datos obtenidos no revelan más información sobre el individuo que la que puede ofrecer la huella dactilar, siendo éste precisamente el fin que habilita y justifica la creación de este Registro.

3. Garantía.

La ley consagra que bajo ningún supuesto el Registro podrá constituir base o fuente de discriminación, estigmatización, vulneración de la dignidad, intimidad, privacidad u honra de persona alguna.

4. Uso cuidadoso de la información.

a la luz del estado de conocimientos científicos hoy en día, se genera un margen de duda en torno a la utilización que se debe dar a estos antecedentes codificados, en atención al correcto amparo de derechos individuales que pudieren encontrarse comprometidos, considerando en ello particularmente la alta y compleja calidad de la información radicada en la huella genética individual.

Para tales efectos se establecen los siguientes criterios:

a. Obligación de reserva.

La ley establece la obligación de mantener la reserva respecto de la información contenida en el Registro a todos aquellos que en razón de su función tomen conocimiento de la información contenida en ellos. Igual prohibición se extiende a quienes hayan obtenido antecedentes de dicha información, y castiga penalmente el no cumplimiento de este apartado.

b. Acceso restringido.

La ley establece que no pueden acceder al Registro si no ciertas y determinadas personas. En primer lugar, el juez o los fiscales del Ministerio Público para los efectos de una investigación o procedimiento penal.

En segundo lugar, la persona que tenga una huella genética en el Registro, para los efectos de acreditar su inocencia o para ser acompañada en juicio sobre acciones de filiación.

c. Establecimiento de delitos

La ley sanciona como delito la divulgación y uso indebido de la información genética.

También sanciona como delito el acceso indebido a la información reservada y la divulgación de la misma.

d. Seguridad

La ley establece, por ejemplo, la obligación del Servicio Médico Legal, de destruir las muestras biológicas que hubieren servido de base para la realización de los exámenes una vez que éstos fueron remitidos al Servicio de Registro Civil e Identificación.

5. Procedimiento para generar el Registro

El Registro pasa por cuatro etapas. En primer lugar, tiene que existir orden judicial o del Ministerio Público para su realización. Sólo son éstas las autoridades competentes para que pueda practicarse el examen de ADN.

En segundo lugar, las muestras las puede extraer únicamente el Servicio Médico Legal. Sólo por razones de urgencia o de distancia, el procedimiento puede ser realizado por el personal de los Servicios de Salud.

En tercer lugar, luego de tomada la muestra, debe procederse al examen de ADN. Esta tarea está a cargo única y exclusivamente del Servicio Médico Legal.

La última etapa es la remisión al Servicio de Registro Civil e Identificación de los exámenes y su incorporación al Registro correspondiente. A partir de ahí, la huella genética se integra a los antecedentes que consten en el prontuario penal del condenado.

6. El Registro de antecedentes accesorios

Sin perjuicio del Registro Nacional de ADN, el proyecto establece el Registro de Antecedentes Accesorios.

El Registro Nacional opera respecto de las personas condenadas. Este otro Registro, en cambio, opera respecto de los imputados o de las víctimas de un delito cuando se hubiere ordenado su extracción.

Los antecedentes que obran en este Registro son temporales. Ellos deben ser eliminados cuando se ponga término al proceso judicial con sentencia condenatoria o hubiere transcurrido el plazo de prescripción de la acción penal.

Esta ley, a la luz de los antecedentes hallados tanto en Chile, en sus cuerpos legales y jurídicos, así como en los antecedentes emanados desde organismos internacionales como Naciones Unidas, Comisiones Internacionales de Bioética y Resguardo de derechos Individuales, la visión de organizaciones policiales como el FBI e INTERPOL, y la experiencia de otros países en las Américas, y Europa, podemos evidenciar que un registro de datos genéticos como el planteado en la referida ley, se ajusta al derecho internacional, cuyos alcances respecto de los derechos individuales es amplio y extenso, no obstante, el alcance de dichos derechos, iguales para victimas y victimarios, debe estar supeditado al Bien Común, cuya administración y resguardo le corresponde por competencias al Estado.

V BIBLIOGRAFÍA

CORRAL TALCIANI, HERNÁN "El derecho a la privacidad y los sistemas de tratamiento de datos personales en la ley N0 19.628 de 1999", en Revista de Derecho, N0 205, año LXVII, enero-junio 1999, Universidad de Concepción.

MALEN, JORGE, "Privacidad y mapa genético", en Bioética y Derecho. Fundamentos y Problemas Actuales, Rodolfo Vásquez (Compilador), F.C.E., 1’ edición 1999, pág. 188.

http:/Iulpiano.com/Recursos Privacidad_LeyChile.html.

Principios rectores para la reglamentación de los ficheros computarizados de datos personales", adoptados por la Asamblea General en su resolución 45/95, de 14 de diciembre de 1990. En Internet en http:// www.unhchr.ch/spanish/html/menu3/b/71-sp.htm.

ALDRIGE, SUSAN, "El hilo de la vida. De los genes a la ingeniería genética", Cambridge, University Press, Madrid 1999, pág. 28.

http:// wwwbarreau.qc.ca/congres/200l /pdf/09-zigayer-fr-pdf

ROMEO CASABONA, CARLOS MARIA ‘Del gen al derecho", Universidad Externado de Colombia, Centro de Estudios sobre Genética y Derecho, Colombia, primera edición, octubre de 1996, pág. 124.

GUILLÉN VÁSQUEZ, MARGARITA; PESTONI, CARMELA y CARRACEDO, ÁNGEL "Bases de datos de ADN con fines de investigación criminal:aspectos técnicos y problemas ético-legales", en Revista de Derecho y Genoma Humano N0 8, 1998, pág. 139.

Consejo de la Unión Europea, Resolución del Consejo de 25 de junio de 2001 relativa al intercambio de resultados de análisis de ADN (Diario Oficial N0 C187 de 03/07/2001), "definiciones", N0 2.

VALLE, SILVIO "Regulamentacao da identificacao humana por ADN" http://www.jus.com.br/doutrinal dna3.html

GUILLÉN VÁSQUEZ, MARGARITA; PESTONI, CARMELA y CARRACEDO, ÁNGEL op. cit. pág. 141.

Análisis de ADN: Determinante para esclarecer homicidio de una joven en Talca", en Revista Detective N0 85, jumo 1995, pág. 30.

LORENTE ACOSTA, MIGUEL, LORENTE ACOSTA, JOSÉ ANTONIO y ILLANUEVA CAÑADAS, "Identificación humana y medicina legal: Consideraciones éticas y jurídicas", http://www.ugr.esPejanes/Biotecnologia/juella.htm

Martine Jacot, "El ADN en el banquilío de los acusados", en "El Correo de la UNESCO, http://www.UNESCO. org. /courrier/2000..04/sp/ethique.htm

CAMPOS BACA, LUIS, Proyecto de Ley N0 5.630, Perú, apartado destinado a la "fundamentación". http://www.congreso.gob.pe/ccd/proyectos/prOOO4/ 00563095.htm.

ZEN ERE, GISELA GUI LLERMINA y BELFORTE, EDUARDO ARI EL, FI peritaje deADN’, ponencia N09 al II Congreso Internacional Derechos y Garantías en el siglo XXI, Buenos Aires, 25, 26y 27 de abril de 2001. Colegio de Abogados de Buenos Aires.

MÁRQUEZ PIÑERO, RAFAEL, ‘Identificación genética y Derecho Penal’, Identificación genética y derecho penal", en Infojus, Instituto de investigaClones Jurídicas de la Universidad Nacional Autónoma de México, http:// infojurid icas.unam.mx/publica /salud /cuad3/marqucz.htm, 31-05-2091

R, HOWARD, citado por Elena Larrauri en ‘La herencm ttucrrniinología crítica", Siglo XXI Editores, segunda edición, 1992, pág. 29.

LEMERT, EDWIN, citado por Elena Larrauri, op. cit., pág. 28.

La estructura de las revoluciones científicas", de T. 5. KUHN. en español, ediciones del FCE, reimpresiones en Chile 1993.

Interpol, "Interpol DNA Profile Search los contenidos de la ficha en http://www.interpoI.int/PubliC/ Forensic/ dna 1 form/guidelinesForm.pdf

análisis de la legislación norteamericana. base de Estatutos Estatales de la Base de Datos de ADN, CODIS, resumen de disposiciones", preparado para la Oficina de Investigación Federal, FBI, División de Laboratorio, por M. Dawn Herkenham, julio 1999.

http://www.lexjuris.com/LEXLEX/ LEY~ 998/ LEX981 75.h

http://newrton.prensa.Com/hOy/eSpCCial/dCU da/index.shtml Rolando Rodríguez B., Mónica Palm y Lina Vega Abada, con la colaboración de Betty Brannan Jaen.

Gaceta Oficial N" 23, 684 de 2 de diciembre de 1998.CAMPOS BACA, LUIS, op. C

CAMPOS BACA, LUIS, op. cit. art. 40·

Loi sur Videntification les empreintes génétiqtíes, artículo 4".

CAMPOS BACA, LUIS, op. cit., Capítulo V "Aspectos . comprende los artículos 12 al 14 del proyecto.

El Laboratorio de Identificación por ADN de las Fuerzas Arniadas norteamericanas, AFDIL,

National DNA índex Sistem", en http://www.fbi.gov/hq/IM’í codis¡national.htm.

States Participating in NDIS, en http://www.fbi.gov/hq/Iab/codísi partstates.htn

Estados miembros representados en el DNA MEG, Argentina, Australia, Austria, Bélgica, Francia, Noruega, Sud África, España y Reino Unido.

LORENTE J.A., LORENTE M. "El ADN y la identificación en la investigación criminal y en la paternidad biológica" Ed. Comares, Granada, 1995.

LORENTE J.A. "Bases de datos de ADN: su uso en la investigación criminal y en la identificación civil. Anotaciones prácticas para su desarrollo. Forensica 1 2002

MORA J.M. "Aspectos sustantivos y procesales de la tecnología del ADN". Cátedra Interuniversitaria Fundación BBVA-Diputación Foral de Bizkaia de Derecho y Genoma Humano. Universidad de Deusto, Universidad del País Vasco/EHU. Ed. Comares, Granada 2001.

SCHNEIDER P.M., MARTIN P.D. Criminal DNA databases: the European situation. Forensic Science International 119:232-238 (2001)

MARTIN P.D., SCHMIT~ER H., SCHNEIDER P.M. A brief history of the formation of DNA databases in forensic science within Europe. Forensic Science International 119: 225-231 (2001).

Grupo Iberoamericano de Trabajo en el Análisis del DNA (GITAD), perteneciente a la Academia Iberoamericana de Criminalística y Estudios Forenses (AICEF): www.gitad.org


Partes: 1, 2, 3, 4, 5, 6, 7, 8, 9


 Página anterior Volver al principio del trabajoPágina siguiente 

Comentarios


Trabajos relacionados

  • Criminologia: Dactiloscopia

    En que consiste la dactiloscopia. La piel. Las crestas papilares. Modernos sistemas de identificación. Es la ciencia qu...

  • Condiciones ambientales y delitos

    Descripción general de la Urbanización. Descripción de las propiedades. Uso de las viviendas. Nivel de ocupación. Descri...

  • Estafas y otras defraudaciones

    Análisis de la legislación vigente. Aparentar bienes, crédito, comisión, empresa o negociación. Desbaratamiento de los d...

Ver mas trabajos de Criminologia

 

Nota al lector: es posible que esta página no contenga todos los componentes del trabajo original (pies de página, avanzadas formulas matemáticas, esquemas o tablas complejas, etc.). Recuerde que para ver el trabajo en su versión original completa, puede descargarlo desde el menú superior.


Todos los documentos disponibles en este sitio expresan los puntos de vista de sus respectivos autores y no de Monografias.com. El objetivo de Monografias.com es poner el conocimiento a disposición de toda su comunidad. Queda bajo la responsabilidad de cada lector el eventual uso que se le de a esta información. Asimismo, es obligatoria la cita del autor del contenido y de Monografias.com como fuentes de información.