Descargar

Comentar este trabajo

Agregar a favoritos

Enviar a un amigo

Trabajos relacionados

(Viene de la página anterior)

Página anterior

Volver al principio del trabajo

Página siguiente

Partes: 1, 2, 3, 4, 5, 6, 7, 8, 9

D5S818

Other Names	Chromosomal Location	GenBank Accession
D5	5q21-q31	G08446; has 11 repeat units AC008512; has 9 repeat units

Repeat: [AGAT] = GenBank top strand

Reported Primers	Ref.	PCR Primer Sequences
Set 1	Promega	GenePrint^® PowerPlex™ 1.1
Set 2	453	5'-GGGTGATTTTCCTCTTTGGT-3' 5'-TGATTCCAATCATAGCCACA-3'
Set 3	ABI	AmpFlSTR^® Profiler Plus™

PCR Product Sizes of Observed Alleles

Allele (Repeat #)	Set 1	Set 2	Set 3	Repeat Structure	Ref.
7	119 bp	133 bp	134 bp	[AGAT]₇	721
8	123 bp	137 bp	138 bp	[AGAT]₈	721
9	127 bp	141 bp	142 bp	[AGAT]₉	721
10	131 bp	145 bp	146 bp	[AGAT]₁₀	721
11	135 bp	149 bp	150 bp	[AGAT]₁₁	721
12	139 bp	153 bp	154 bp	[AGAT]₁₂	721
13	143 bp	157 bp	158 bp	[AGAT]₁₃	721
14	147 bp	161 bp	162 bp	[AGAT]₁₄	721
15	151 bp	165 bp	166 bp	[AGAT]₁₅	721
16	155 bp	169 bp	170 bp		Profiler Plus

CSF1PO

Other Names	Chromosomal Location	GenBank Accession
CSF	5q33.3-34; human c-fms proto-oncogene for CSF-1 receptor gene	X14720; has 12 repeats

Repeat: [AGAT] = GenBank top strand (commonly used)

Reported Primers	Ref.	PCR Primer Sequences
Set 1	3	5'-AACCTGAGTCTGCCAAGGACTAGC-3' (AGAT strand) 5'-TTCCACACACCACTGGCCATCTTC-3' (TCTA strand)
Set 2	Promega	GenePrint^® PowerPlex™ 1.1
Set 3	ABI	AmpFlSTR^® COfiler™

PCR Product Sizes of Observed Alleles

Allele (Repeat #)	Set 1 & Set 2	Set 3	Repeat Structure	Ref.
6	291 bp	281 bp	[AGAT]₆
7	295 bp	285 bp	[AGAT]₇	153
8	299 bp	289 bp	[AGAT]₈	28
9	303 bp	293 bp	[AGAT]₉	28
9.1	302 bp	294 bp		*variant allele*
10	307 bp	297 bp	[AGAT]₁₀	28
10.1	308 bp	298 bp		*variant allele*
10.3	310 bp	300 bp		Budowle 1998
11	311 bp	301 bp	[AGAT]₁₁	28
12	315 bp	305 bp	[AGAT]₁₂	28
12.1	316 bp	306 bp		Budowle 1998
13	319 bp	309 bp	[AGAT]₁₃	28
14	323 bp	313 bp	[AGAT]₁₄	28
15	327 bp	317 bp	[AGAT]₁₅	285
16	331bp	321 bp		Margolis-Nunno,H., et. al, 2001

D7S820

Other Names	Chromosomal Location	GenBank Accession
D7	7q	G08616; has 12 repeat units AC004848; has 13 repeat units

Repeat: [GATA] = GenBank top strand

Reported Primers	Ref.	PCR Primer Sequences
Set 1	Promega	GenePrint^® PowerPlex™ 1.1
Set 2	ABI	AmpFlSTR^® Profiler Plus™
Set 3	453	5'-TGTCATAGTTTAGAACGAACTAACG-3' 5'-CTGAGGTATCAAAAACTCAGAGG-3'

PCR Product Sizes of Observed Alleles

Allele (Repeat #)	Set 1	Set 2	Set 3	Repeat Structure	Ref.
5	211 bp	253 bp	194 bp		*variant allele*
6	215 bp	257 bp	198 bp	[GATA]₆	₇₂₁
6.3	218 bp	260 bp	201 bp		_{Profiler Plus}
7	219 bp	261 bp	202 bp	[GATA]₇	₇₂₁
7.3	222 bp	264 bp	205 bp		*variant allele*
8	223 bp	265 bp	206 bp	[GATA]₈	₇₂₁
8.1	224 bp	266 bp	207 bp		*variant allele*
8.2	225 bp	267 bp	208 bp		*variant allele*
9	227 bp	269 bp	210 bp	[GATA]₉	₇₂₁
9.1	228 bp	270 bp	211 bp		*variant allele*
9.3	230 bp	272 bp	213 bp		*variant allele*
10	231 bp	273 bp	214 bp	[GATA]₁₀	₇₂₁
10.1	232 bp	274 bp	215 bp		*variant allele*
10.3	234 bp	276 bp	217 bp		*variant allele*
11	235 bp	277 bp	218 bp	[GATA]₁₁	₇₂₁
11.1	236 bp	278 bp	219 bp		*variant allele*
12	239 bp	281 bp	222 bp	[GATA]₁₂	₇₂₁
12.1	240 bp	282 bp	223 bp		*variant allele*
13	243 bp	285 bp	226 bp	[GATA]₁₃	₇₂₁
13.1	244 bp	286 bp	227 bp		*variant allele*
14	247 bp	289 bp	230 bp	[GATA]₁₄	₇₂₁
15	251 bp	293 bp	234 bp		_{Profiler Plus}

D8S1179

Other Names	Chromosomal Location	GenBank Accession
D6S502	8q24.1-24.2	GO8710; has 12 repeat units AF216671; has 13 repeat units

Repeat: [TATC] = GenBank top strand (called [TCTA] by FSS {375})

Primers	Ref.	PCR Primer Sequences
Set 1	CHLC Web Site, 369	5' - TTTTTGTATTTCATGTGTACATTCG - 3' 5' - CGTAGCTATAATTAGTTCATTTTCA - 3'
Set 2	PE ABI	AmpFlSTR Profiler Plus
Set 3	Promega	PowerPlex 2.1

PCR Product Sizes of Observed Alleles

Allele (Repeat #)	Set 1	Set 2	Set 3	Repeat Structure	Ref.
7	157 bp	123 bp	203 bp	[TCTA]₇	716
8	161 bp	127 bp	207 bp	[TCTA]₈	369
9	165 bp	131 bp	211 bp	[TCTA]₉	369
10	169 bp	135 bp	215 bp	[TCTA]₁₀	369
11	173 bp	139 bp	219 bp	[TCTA]₁₁	369
12	177 bp	143 bp	223 bp	[TCTA]₁₂	369
13	181 bp	147 bp	227 bp	[TCTA]₁[TCTG]₁[TCTA]₁₁	369
14	185 bp	151 bp	231 bp	[TCTA]₁[TCTG]₁[TCTA]₁₂	369
15	189 bp	155 bp	235 bp	[TCTA]₁[TCTG]₁[TCTA]₁₃	369
16	193 bp	159 bp	239 bp	[TCTA]₂[TCTG]₁[TCTA]₁₃	369
17	197 bp	163 bp	243 bp	[TCTA]₂[TCTG]₂[TCTA]₁₃	369
18	201 bp	167 bp	247 bp	[TCTA]₂[TCTG]₁[TCTA]₁₅	369
19	205 bp	171 bp	251 bp	[TCTA]₂[TCTG]₂[TCTA]₁₅	716

HUMTH01

Other Names	Chromosomal Location	GenBank Accession
TH01, TC11	11p15-15.5; intron 1 of human tyrosine hydroxylase gene	D00269; has 9 repeat units

Repeat: [AATG] = bottom strand (commonly used); [TCAT] = GenBank top strand

Reported Primers	Ref.	PCR Primer Sequences
Set 1	1, 3	5'-GTGGGCTGAAAAGCTCCCGATTAT-3' (AATG strand) 5'-ATTCAAAGGGTATCTGGGCTCTGG-3' (TCAT strand)
Set 2	4	5'-GTGGGCTGAAAAGCTCCCGATTAT-3' (AATG strand) 5'-GTGATTCCCATTGGCCTGTTCCTC-3' (TCAT strand)
Set 3	125	5'-GCTTCCGAGTGCAGGTCACA-3' (AATG strand) 5'-CAGCTGCCCTAGTCAGCAC-3' (TCAT strand)
Set 4	Promega	GenePrint^® PowerPlex™ 1.1
Set 5	ABI	AmpFlSTR^® COfiler™
Set 6	Promega	GenePrint^® PowerPlex™ 2.1

PCR Product Sizes of Observed Alleles

Allele (Repeat #)	Set 1, 4	Set 2	Set 3	Set 5	Set 6	Repeat Structure	Ref.
3	171 bp	146 bp	230 bp	160 bp	152 bp	[AATG]₃	290
4	175 bp	150 bp	234 bp	164 bp	156 bp	[AATG]₄	716
5	179 bp	154 bp	238 bp	168 bp	160 bp	[AATG]₅	76
5.3	182 bp	157 bp	241 bp	171 bp	163 bp		SGM Plus
6	183 bp	158 bp	242 bp	172 bp	164 bp	[AATG]₆	76
6.1	184 bp	159 bp	243 bp	173 bp	165 bp		SGM Plus
6.3	186 bp	161 bp	245 bp	175 bp	167 bp	[AATG]₃ATG[AATG]₃	632
7	187 bp	162 bp	246 bp	176 bp	168 bp	[AATG]₇	76
7.1	188 bp	163 bp	247 bp	177 bp	169 bp		SGM Plus
7.3	190 bp	165 bp	249 bp	179 bp	171 bp		SGM Plus
8	191 bp	166 bp	250 bp	180 bp	172 bp	[AATG]₈	76
8.3	194 bp	169 bp	253 bp	183 bp	175 bp	[AATG]₅ATG[AATG]₃	76
9	195 bp	170 bp	254 bp	184 bp	176 bp	[AATG]₉	76
9.3	198 bp	173 bp	257 bp	187 bp	179 bp	[AATG]₆ATG[AATG]₃	76
10	199 bp	174 bp	258 bp	188 bp	180 bp	[AATG]₁₀	76
10.3	202 bp	177 bp	261 bp	191 bp	183 bp	[AATG]₆ATG[AATG]₄	76
11	203 bp	178 bp	262 bp	192 bp	184 bp	[AATG]₁₁	76
12	207 bp	182 bp	266 bp	196 bp	188 bp	[AATG]₁₂	112
13.3	214 bp	189 bp	273 bp	203 bp	195 bp	[AATG][AACT][AATG]₈ATG[AATG]₃	377
14	215 bp	190 bp	274 bp	204 bp	196 bp		SGM Plus

VWA

Other Names	Chromosomal Location	GenBank Accession
vWF, VWA31A	12p12-pter	M25858; has 18 (20) repeat units

Repeat: [AGAT] = bottom strand (commonly used); [TCTA] with [TCTG] and [TCCA] inserts = GenBank top strand

Reported Primers	Ref.	PCR Primer Sequences
Set 1	113	5'-CCCTAGTGGATAAGAATAATC-3' 5'-GGACAGATGATAAATACATAGGATGGATGG-3'
Set 1'	7	5'-CCCTAGTGGATGATAAGAATAATCAGTATG-3' 5'-GGACAGATGATAAATACATAGGATGGATGG-3'
Set 2	Promega	GenePrint^® PowerPlex™ 1.1
Set 3	ABI	AmpFlSTR^® Profiler Plus™

PCR Product Sizes of Observed Alleles

Allele (Repeat #)	Set 1, 1'	Set 2	Set 3	Repeat Structure	Ref.
10	122 bp	123 bp	152 bp	TCTA TCTG TCTA [TCTG]₄[TCTA]₃	716
11 (13')*	126 bp	127 bp	156 bp	TCTA[TCTG]₃[TCTA]₇	76
12	130 bp	131 bp	160 bp	TCTA[TCTG]₄[TCTA]₇	7
13	134 bp	135 bp	164 bp	[TCTA]₂[TCTG]₄[TCTA]₃TCCA[TCTA]₃	716
13 (15)	134 bp	135 bp	164 bp	TCTA[TCTA]₄[TCTA]₈TCCATCTA	76
13 (15'')	134 bp	135 bp	164 bp	TCTA[TCTA]₄[TCTA]₁₀	76
14 (16'')	138 bp	139 bp	168 bp	TCTA[TCTG]₄[TCTA]₁₁	76
14 (16''')	138 bp	139 bp	168 bp	TCTA[TCTG]₁[TCTA]₁[TCTG]₄[TCTA]₃TCCA [TCTA]₃	76
15 (17)	142 bp	143 bp	172 bp	TCTA[TCTG]₄[TCTA]₁₀TCCATCTA	76
15 (17')	142 bp	143 bp	172 bp	TCTA[TCTG]₃[TCTA]₁₁TCCATCTA	76
15.2	144 bp	145 bp	174 bp		7
16 (18)	146 bp	147 bp	176 bp	TCTA[TCTG]₄[TCTA]₁₁TCCATCTA	76
16 (18')	146 bp	147 bp	176 bp	TCTA[TCTG]₃[TCTA]₁₂TCCATCTA	76
16.1	147 bp	148 bp	177 bp		*variant allele*
17 (19)	150 bp	151 bp	180 bp	TCTA[TCTG]₄[TCTA]₁₂TCCATCTA	76
18 (20)	154 bp	155 bp	184 bp	TCTA[TCTG]₄[TCTA]₁₃TCCATCTA	76
18 (20')	154 bp	155 bp	184 bp	TCTA[TCTG]₅[TCTA]₁₂TCCATCTA	76
18.2	156 bp	157 bp	186 bp		SGM Plus
18.3	157 bp	158 bp	187 bp		SGM Plus
19 (21)	158 bp	159 bp	188 bp	TCTA[TCTG]₄[TCTA]₁₄TCCATCTA	76
20 (22)	162 bp	163 bp	192 bp	TCTA[TCTG]₄[TCTA]₁₅TCCATCTA	76
21 (23)	166 bp	167 bp	196 bp	TCTA[TCTG]₄[TCTA]₁₆TCCATCTA	76
22 (24)	170 bp	171 bp	200 bp	TCTA[TCTG]₄[TCTA]₁₇TCCATCTA	76
23	174 bp	175 bp	204 bp		SGM Plus
24	178 bp	179 bp	208 bp		SGM Plus
25	182 bp	181 bp	212 bp		SGM Plus

*Allele designations shown in paratheses come from reference 76.

D13S317

Other Names	Chromosomal Location	GenBank Accession
D13	13q22-q31	G09017; has 13 repeat units AL353628.2

Repeat: [GATA] = bottom strand (commonly used); [TATC] = GenBank top strand

Reported Primers	Ref.	PCR Primer Sequences
Set 1	Promega	GenePrint^® PowerPlex™ 1.1
Set 2	453	5'-ACAGAAGTCTGGGATGTGGA-3' 5'-GCCCAAAAAGACAGACAGAA-3'
Set 3	ABI	AmpFlSTR^® Profiler Plus™

PCR Product Sizes of Observed Alleles

Allele (Repeat #)	Set 1,2	Set 3	Repeat Structure	Ref.
5	157	193		Profiler Plus
7	165 bp	201	[TATC]₇	₇₂₁
7.1	166	202		*variant allele*
8	169 bp	205	[TATC]₈	₇₂₁
8.1	170	206		*variant allele*
9	173 bp	209	[TATC]₉	₇₂₁
10	177 bp	213	[TATC]₁₀	₇₂₁
10'	177	213	[TATC]₁₀ AATC	₇₂₁
11	181 bp	217	[TATC]₁₁	₇₂₁
12	185 bp	221	[TATC]₁₂	₇₂₁
13	189 bp	225	[TATC]₁₃	₇₂₁
14	193 bp	229	[TATC]₁₄	₇₂₁
15	197 bp	233	[TATC]₁₅	₇₂₁
16	201	237		*variant allele*

Partes: 1, 2, 3, 4, 5, 6, 7, 8, 9

Página anterior

Volver al principio del trabajo

Página siguiente

Iniciar sesión

Ingrese el e-mail y contraseña con el que está registrado en Monografias.com

Regístrese gratis

¿Olvidó su contraseña?

Ayuda

Comentarios

Trabajos relacionados

La investigación criminal

Estructura de la investigación criminal. Importancia para la criminalistica. El juicio previo y el debido proceso, la p...
La teoría Crítica Social y sus aportaciones a la criminología

Teoría critica de la sociedad: orígenes e influencias en las ciencias sociales. Convergencias con las teorías psicoanalí...
Estudio forense del pelo - Criminalistica

Morfología. Importancia del pelo como indicio. Características del pelo según su análisis. Pelo caído, arrancado o corta...

Ver mas trabajos de Criminologia

Nota al lector: es posible que esta página no contenga todos los componentes del trabajo original (pies de página, avanzadas formulas matemáticas, esquemas o tablas complejas, etc.). Recuerde que para ver el trabajo en su versión original completa, puede descargarlo desde el menú superior.

Todos los documentos disponibles en este sitio expresan los puntos de vista de sus respectivos autores y no de Monografias.com. El objetivo de Monografias.com es poner el conocimiento a disposición de toda su comunidad. Queda bajo la responsabilidad de cada lector el eventual uso que se le de a esta información. Asimismo, es obligatoria la cita del autor del contenido y de Monografias.com como fuentes de información.

Iniciar sesión

Comentarios

Trabajos relacionados

La investigación criminal

La teoría Crítica Social y sus aportaciones a la criminología

Estudio forense del pelo - Criminalistica